ID: 1196296016

View in Genome Browser
Species Human (GRCh38)
Location X:113998342-113998364
Sequence CTGGTGACACAGATCAAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196296016_1196296019 -4 Left 1196296016 X:113998342-113998364 CCATGTTTGATCTGTGTCACCAG No data
Right 1196296019 X:113998361-113998383 CCAGTAAAATATGGCAGAACTGG No data
1196296016_1196296023 10 Left 1196296016 X:113998342-113998364 CCATGTTTGATCTGTGTCACCAG No data
Right 1196296023 X:113998375-113998397 CAGAACTGGGCCGGGCACAGTGG No data
1196296016_1196296020 -3 Left 1196296016 X:113998342-113998364 CCATGTTTGATCTGTGTCACCAG No data
Right 1196296020 X:113998362-113998384 CAGTAAAATATGGCAGAACTGGG No data
1196296016_1196296021 1 Left 1196296016 X:113998342-113998364 CCATGTTTGATCTGTGTCACCAG No data
Right 1196296021 X:113998366-113998388 AAAATATGGCAGAACTGGGCCGG No data
1196296016_1196296022 2 Left 1196296016 X:113998342-113998364 CCATGTTTGATCTGTGTCACCAG No data
Right 1196296022 X:113998367-113998389 AAATATGGCAGAACTGGGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196296016 Original CRISPR CTGGTGACACAGATCAAACA TGG (reversed) Intergenic
No off target data available for this crispr