ID: 1196296019

View in Genome Browser
Species Human (GRCh38)
Location X:113998361-113998383
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196296016_1196296019 -4 Left 1196296016 X:113998342-113998364 CCATGTTTGATCTGTGTCACCAG No data
Right 1196296019 X:113998361-113998383 CCAGTAAAATATGGCAGAACTGG No data
1196296015_1196296019 6 Left 1196296015 X:113998332-113998354 CCATGTTTGACCATGTTTGATCT No data
Right 1196296019 X:113998361-113998383 CCAGTAAAATATGGCAGAACTGG No data
1196296014_1196296019 12 Left 1196296014 X:113998326-113998348 CCTCTTCCATGTTTGACCATGTT No data
Right 1196296019 X:113998361-113998383 CCAGTAAAATATGGCAGAACTGG No data
1196296013_1196296019 13 Left 1196296013 X:113998325-113998347 CCCTCTTCCATGTTTGACCATGT No data
Right 1196296019 X:113998361-113998383 CCAGTAAAATATGGCAGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196296019 Original CRISPR CCAGTAAAATATGGCAGAAC TGG Intergenic
No off target data available for this crispr