ID: 1196296020

View in Genome Browser
Species Human (GRCh38)
Location X:113998362-113998384
Sequence CAGTAAAATATGGCAGAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196296016_1196296020 -3 Left 1196296016 X:113998342-113998364 CCATGTTTGATCTGTGTCACCAG No data
Right 1196296020 X:113998362-113998384 CAGTAAAATATGGCAGAACTGGG No data
1196296015_1196296020 7 Left 1196296015 X:113998332-113998354 CCATGTTTGACCATGTTTGATCT No data
Right 1196296020 X:113998362-113998384 CAGTAAAATATGGCAGAACTGGG No data
1196296014_1196296020 13 Left 1196296014 X:113998326-113998348 CCTCTTCCATGTTTGACCATGTT No data
Right 1196296020 X:113998362-113998384 CAGTAAAATATGGCAGAACTGGG No data
1196296013_1196296020 14 Left 1196296013 X:113998325-113998347 CCCTCTTCCATGTTTGACCATGT No data
Right 1196296020 X:113998362-113998384 CAGTAAAATATGGCAGAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196296020 Original CRISPR CAGTAAAATATGGCAGAACT GGG Intergenic
No off target data available for this crispr