ID: 1196302865

View in Genome Browser
Species Human (GRCh38)
Location X:114066502-114066524
Sequence TAGTTCCTCTGAAGCTTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196302865_1196302868 -3 Left 1196302865 X:114066502-114066524 CCTGCAAAGCTTCAGAGGAACTA No data
Right 1196302868 X:114066522-114066544 CTAGTGTAAAGGTGAAAACAGGG No data
1196302865_1196302870 5 Left 1196302865 X:114066502-114066524 CCTGCAAAGCTTCAGAGGAACTA No data
Right 1196302870 X:114066530-114066552 AAGGTGAAAACAGGGAGAGTGGG No data
1196302865_1196302869 4 Left 1196302865 X:114066502-114066524 CCTGCAAAGCTTCAGAGGAACTA No data
Right 1196302869 X:114066529-114066551 AAAGGTGAAAACAGGGAGAGTGG No data
1196302865_1196302867 -4 Left 1196302865 X:114066502-114066524 CCTGCAAAGCTTCAGAGGAACTA No data
Right 1196302867 X:114066521-114066543 ACTAGTGTAAAGGTGAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196302865 Original CRISPR TAGTTCCTCTGAAGCTTTGC AGG (reversed) Intergenic
No off target data available for this crispr