ID: 1196304706

View in Genome Browser
Species Human (GRCh38)
Location X:114087444-114087466
Sequence CTCTGCATGTGGAAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196304700_1196304706 -9 Left 1196304700 X:114087430-114087452 CCATGGAGAGGCTCCTCTGCATG No data
Right 1196304706 X:114087444-114087466 CTCTGCATGTGGAAGGTGGAGGG No data
1196304695_1196304706 9 Left 1196304695 X:114087412-114087434 CCACCCTGAGGGTGGTGACCATG No data
Right 1196304706 X:114087444-114087466 CTCTGCATGTGGAAGGTGGAGGG No data
1196304693_1196304706 17 Left 1196304693 X:114087404-114087426 CCTGTGGACCACCCTGAGGGTGG No data
Right 1196304706 X:114087444-114087466 CTCTGCATGTGGAAGGTGGAGGG No data
1196304698_1196304706 5 Left 1196304698 X:114087416-114087438 CCTGAGGGTGGTGACCATGGAGA No data
Right 1196304706 X:114087444-114087466 CTCTGCATGTGGAAGGTGGAGGG No data
1196304692_1196304706 18 Left 1196304692 X:114087403-114087425 CCCTGTGGACCACCCTGAGGGTG No data
Right 1196304706 X:114087444-114087466 CTCTGCATGTGGAAGGTGGAGGG No data
1196304689_1196304706 30 Left 1196304689 X:114087391-114087413 CCTGAAAGTAGTCCCTGTGGACC No data
Right 1196304706 X:114087444-114087466 CTCTGCATGTGGAAGGTGGAGGG No data
1196304697_1196304706 6 Left 1196304697 X:114087415-114087437 CCCTGAGGGTGGTGACCATGGAG No data
Right 1196304706 X:114087444-114087466 CTCTGCATGTGGAAGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196304706 Original CRISPR CTCTGCATGTGGAAGGTGGA GGG Intergenic
No off target data available for this crispr