ID: 1196313840

View in Genome Browser
Species Human (GRCh38)
Location X:114199439-114199461
Sequence GTCAACTAGCAAGTAATGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196313840_1196313842 0 Left 1196313840 X:114199439-114199461 CCAGTCATTACTTGCTAGTTGAC No data
Right 1196313842 X:114199462-114199484 TGTATGTCAAGGAACTATAATGG No data
1196313840_1196313843 22 Left 1196313840 X:114199439-114199461 CCAGTCATTACTTGCTAGTTGAC No data
Right 1196313843 X:114199484-114199506 GTGTGACATGTATAATTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196313840 Original CRISPR GTCAACTAGCAAGTAATGAC TGG (reversed) Intergenic
No off target data available for this crispr