ID: 1196313945

View in Genome Browser
Species Human (GRCh38)
Location X:114200836-114200858
Sequence CCCCTAAGGCACCAAAAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196313937_1196313945 30 Left 1196313937 X:114200783-114200805 CCCCAGAGTGTGGCCTTCTGAAA No data
Right 1196313945 X:114200836-114200858 CCCCTAAGGCACCAAAAGTCAGG No data
1196313939_1196313945 28 Left 1196313939 X:114200785-114200807 CCAGAGTGTGGCCTTCTGAAAGC No data
Right 1196313945 X:114200836-114200858 CCCCTAAGGCACCAAAAGTCAGG No data
1196313938_1196313945 29 Left 1196313938 X:114200784-114200806 CCCAGAGTGTGGCCTTCTGAAAG No data
Right 1196313945 X:114200836-114200858 CCCCTAAGGCACCAAAAGTCAGG No data
1196313941_1196313945 17 Left 1196313941 X:114200796-114200818 CCTTCTGAAAGCAGGTGTCAGAG No data
Right 1196313945 X:114200836-114200858 CCCCTAAGGCACCAAAAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196313945 Original CRISPR CCCCTAAGGCACCAAAAGTC AGG Intergenic
No off target data available for this crispr