ID: 1196318990

View in Genome Browser
Species Human (GRCh38)
Location X:114266544-114266566
Sequence CTGGAGGCTGAGAGCTACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196318986_1196318990 3 Left 1196318986 X:114266518-114266540 CCAAGGGAAAGAGAAAGCAAGAT No data
Right 1196318990 X:114266544-114266566 CTGGAGGCTGAGAGCTACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196318990 Original CRISPR CTGGAGGCTGAGAGCTACAA TGG Intergenic
No off target data available for this crispr