ID: 1196324454

View in Genome Browser
Species Human (GRCh38)
Location X:114386075-114386097
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196324454_1196324461 14 Left 1196324454 X:114386075-114386097 CCCATACCTCCTTACTCTCTTGT No data
Right 1196324461 X:114386112-114386134 ATTTACATTTTGCACTGGTATGG No data
1196324454_1196324460 9 Left 1196324454 X:114386075-114386097 CCCATACCTCCTTACTCTCTTGT No data
Right 1196324460 X:114386107-114386129 CTATTATTTACATTTTGCACTGG No data
1196324454_1196324462 15 Left 1196324454 X:114386075-114386097 CCCATACCTCCTTACTCTCTTGT No data
Right 1196324462 X:114386113-114386135 TTTACATTTTGCACTGGTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196324454 Original CRISPR ACAAGAGAGTAAGGAGGTAT GGG (reversed) Intergenic
No off target data available for this crispr