ID: 1196324457

View in Genome Browser
Species Human (GRCh38)
Location X:114386084-114386106
Sequence GGAAAACTGACAAGAGAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196324457_1196324465 27 Left 1196324457 X:114386084-114386106 CCTTACTCTCTTGTCAGTTTTCC No data
Right 1196324465 X:114386134-114386156 GGCCATCTGTTACAGTTGGTGGG No data
1196324457_1196324462 6 Left 1196324457 X:114386084-114386106 CCTTACTCTCTTGTCAGTTTTCC No data
Right 1196324462 X:114386113-114386135 TTTACATTTTGCACTGGTATGGG No data
1196324457_1196324461 5 Left 1196324457 X:114386084-114386106 CCTTACTCTCTTGTCAGTTTTCC No data
Right 1196324461 X:114386112-114386134 ATTTACATTTTGCACTGGTATGG No data
1196324457_1196324463 23 Left 1196324457 X:114386084-114386106 CCTTACTCTCTTGTCAGTTTTCC No data
Right 1196324463 X:114386130-114386152 TATGGGCCATCTGTTACAGTTGG No data
1196324457_1196324460 0 Left 1196324457 X:114386084-114386106 CCTTACTCTCTTGTCAGTTTTCC No data
Right 1196324460 X:114386107-114386129 CTATTATTTACATTTTGCACTGG No data
1196324457_1196324464 26 Left 1196324457 X:114386084-114386106 CCTTACTCTCTTGTCAGTTTTCC No data
Right 1196324464 X:114386133-114386155 GGGCCATCTGTTACAGTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196324457 Original CRISPR GGAAAACTGACAAGAGAGTA AGG (reversed) Intergenic
No off target data available for this crispr