ID: 1196324460

View in Genome Browser
Species Human (GRCh38)
Location X:114386107-114386129
Sequence CTATTATTTACATTTTGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196324454_1196324460 9 Left 1196324454 X:114386075-114386097 CCCATACCTCCTTACTCTCTTGT No data
Right 1196324460 X:114386107-114386129 CTATTATTTACATTTTGCACTGG No data
1196324457_1196324460 0 Left 1196324457 X:114386084-114386106 CCTTACTCTCTTGTCAGTTTTCC No data
Right 1196324460 X:114386107-114386129 CTATTATTTACATTTTGCACTGG No data
1196324456_1196324460 3 Left 1196324456 X:114386081-114386103 CCTCCTTACTCTCTTGTCAGTTT No data
Right 1196324460 X:114386107-114386129 CTATTATTTACATTTTGCACTGG No data
1196324455_1196324460 8 Left 1196324455 X:114386076-114386098 CCATACCTCCTTACTCTCTTGTC No data
Right 1196324460 X:114386107-114386129 CTATTATTTACATTTTGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196324460 Original CRISPR CTATTATTTACATTTTGCAC TGG Intergenic