ID: 1196324462

View in Genome Browser
Species Human (GRCh38)
Location X:114386113-114386135
Sequence TTTACATTTTGCACTGGTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196324454_1196324462 15 Left 1196324454 X:114386075-114386097 CCCATACCTCCTTACTCTCTTGT No data
Right 1196324462 X:114386113-114386135 TTTACATTTTGCACTGGTATGGG No data
1196324456_1196324462 9 Left 1196324456 X:114386081-114386103 CCTCCTTACTCTCTTGTCAGTTT No data
Right 1196324462 X:114386113-114386135 TTTACATTTTGCACTGGTATGGG No data
1196324455_1196324462 14 Left 1196324455 X:114386076-114386098 CCATACCTCCTTACTCTCTTGTC No data
Right 1196324462 X:114386113-114386135 TTTACATTTTGCACTGGTATGGG No data
1196324457_1196324462 6 Left 1196324457 X:114386084-114386106 CCTTACTCTCTTGTCAGTTTTCC No data
Right 1196324462 X:114386113-114386135 TTTACATTTTGCACTGGTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196324462 Original CRISPR TTTACATTTTGCACTGGTAT GGG Intergenic
No off target data available for this crispr