ID: 1196324932

View in Genome Browser
Species Human (GRCh38)
Location X:114391370-114391392
Sequence TCAACACGATGGCTTCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196324932_1196324937 29 Left 1196324932 X:114391370-114391392 CCCTCCAGAAGCCATCGTGTTGA No data
Right 1196324937 X:114391422-114391444 TGATATTTGTTAATAATTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196324932 Original CRISPR TCAACACGATGGCTTCTGGA GGG (reversed) Intergenic
No off target data available for this crispr