ID: 1196326097

View in Genome Browser
Species Human (GRCh38)
Location X:114404949-114404971
Sequence CACCTCCCAACACTGTTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196326097_1196326102 -9 Left 1196326097 X:114404949-114404971 CCAAGCAACAGTGTTGGGAGGTG No data
Right 1196326102 X:114404963-114404985 TGGGAGGTGGGGCTTAATGAGGG No data
1196326097_1196326101 -10 Left 1196326097 X:114404949-114404971 CCAAGCAACAGTGTTGGGAGGTG No data
Right 1196326101 X:114404962-114404984 TTGGGAGGTGGGGCTTAATGAGG No data
1196326097_1196326106 27 Left 1196326097 X:114404949-114404971 CCAAGCAACAGTGTTGGGAGGTG No data
Right 1196326106 X:114404999-114405021 GAGGGTTCCGTCTTTATAAATGG No data
1196326097_1196326103 -8 Left 1196326097 X:114404949-114404971 CCAAGCAACAGTGTTGGGAGGTG No data
Right 1196326103 X:114404964-114404986 GGGAGGTGGGGCTTAATGAGGGG No data
1196326097_1196326104 8 Left 1196326097 X:114404949-114404971 CCAAGCAACAGTGTTGGGAGGTG No data
Right 1196326104 X:114404980-114405002 TGAGGGGTGTTTCATTCATGAGG No data
1196326097_1196326105 9 Left 1196326097 X:114404949-114404971 CCAAGCAACAGTGTTGGGAGGTG No data
Right 1196326105 X:114404981-114405003 GAGGGGTGTTTCATTCATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196326097 Original CRISPR CACCTCCCAACACTGTTGCT TGG (reversed) Intergenic
No off target data available for this crispr