ID: 1196335707

View in Genome Browser
Species Human (GRCh38)
Location X:114530771-114530793
Sequence TAAATATTCCACATATATAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196335707_1196335709 27 Left 1196335707 X:114530771-114530793 CCGATATATATGTGGAATATTTA No data
Right 1196335709 X:114530821-114530843 TTACTATTTTTCTTTGGTAATGG No data
1196335707_1196335708 21 Left 1196335707 X:114530771-114530793 CCGATATATATGTGGAATATTTA No data
Right 1196335708 X:114530815-114530837 AGTCATTTACTATTTTTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196335707 Original CRISPR TAAATATTCCACATATATAT CGG (reversed) Intergenic
No off target data available for this crispr