ID: 1196339469

View in Genome Browser
Species Human (GRCh38)
Location X:114581322-114581344
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196339459_1196339469 9 Left 1196339459 X:114581290-114581312 CCACAGCCTTAGAAACCGGGAAA No data
Right 1196339469 X:114581322-114581344 ACCGTGTTCCGGGGGGCACTGGG No data
1196339460_1196339469 3 Left 1196339460 X:114581296-114581318 CCTTAGAAACCGGGAAATATTTG No data
Right 1196339469 X:114581322-114581344 ACCGTGTTCCGGGGGGCACTGGG No data
1196339462_1196339469 -6 Left 1196339462 X:114581305-114581327 CCGGGAAATATTTGGAAACCGTG No data
Right 1196339469 X:114581322-114581344 ACCGTGTTCCGGGGGGCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196339469 Original CRISPR ACCGTGTTCCGGGGGGCACT GGG Intergenic