ID: 1196340929

View in Genome Browser
Species Human (GRCh38)
Location X:114596608-114596630
Sequence AACTCCTTTGAGTCTTTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 1, 2: 1, 3: 16, 4: 138}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196340924_1196340929 -6 Left 1196340924 X:114596591-114596613 CCTCTATTTGTATTCAGAACTCC 0: 1
1: 0
2: 2
3: 13
4: 148
Right 1196340929 X:114596608-114596630 AACTCCTTTGAGTCTTTGGGGGG 0: 1
1: 1
2: 1
3: 16
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196340929 Original CRISPR AACTCCTTTGAGTCTTTGGG GGG Intronic
901078401 1:6569908-6569930 AAATCCTCTGGGTCTTTGGCAGG + Intronic
904060103 1:27702392-27702414 AAAACCTTTGTCTCTTTGGGAGG + Intergenic
904251333 1:29226473-29226495 AAATCATTTGAGACTTTGGGAGG + Intronic
905203636 1:36330378-36330400 AAGTCCTCTGGGTCTTTGGCAGG - Intergenic
906229306 1:44147136-44147158 CACTGCTTTGCGTCTTTGGTCGG + Intergenic
907293261 1:53431775-53431797 AAGTCTTTTGAGCCTTTGGAAGG - Intergenic
910836299 1:91516230-91516252 AAATGCTTTAAGTCTTTGGCTGG - Intronic
916130670 1:161608362-161608384 AAGTCTTTTGACTTTTTGGGGGG + Intronic
917083899 1:171286161-171286183 ATCTGATTTGGGTCTTTGGGAGG - Intergenic
922634718 1:227156409-227156431 AAAGTCTTTGAGACTTTGGGAGG - Intronic
1063257860 10:4348954-4348976 AACACCTTTGATTCTTTGGAAGG - Intergenic
1063613188 10:7580454-7580476 CACTCCTGTGAGCATTTGGGTGG - Intronic
1065113474 10:22462083-22462105 AAGTCCTGGGAGTCTTTGGGAGG + Intergenic
1066578452 10:36852487-36852509 AAATCCTTTATGTCTTTGTGGGG + Intergenic
1066747194 10:38612373-38612395 AACTGGTGTGATTCTTTGGGGGG - Intergenic
1070347308 10:75557460-75557482 AACTGCTTTGGGATTTTGGGAGG + Intronic
1070857125 10:79614736-79614758 CACTCCTTTGAGTCTTTGAATGG + Exonic
1071309633 10:84330111-84330133 AACTCCTTTGACTATTTTGGAGG + Intronic
1072000705 10:91193205-91193227 AGCTCCTTTGGGTCTTTGGCTGG - Intronic
1073662595 10:105493350-105493372 AACTTCTTTCAGTGTTTGGCTGG + Intergenic
1078096301 11:8299329-8299351 TACTCCTTTGTCTCTTTGAGCGG - Intergenic
1081714912 11:45243118-45243140 ATCTCCTGTGAGTCATTGGCTGG - Exonic
1083987635 11:66226690-66226712 AAGGACTTTGAGTCATTGGGAGG + Intronic
1085635575 11:78156919-78156941 AACTCCCTTGATTCTTTGCCTGG - Intergenic
1085914672 11:80871312-80871334 AACATCTTTGAGTTATTGGGAGG - Intergenic
1086990486 11:93298060-93298082 ATCTCCTTTGAGACTTTGAGGGG + Intergenic
1087015450 11:93550285-93550307 AACTCCTTTCAGAATTTTGGGGG + Intergenic
1089147178 11:116337616-116337638 AAGTCCTCTGAGCCTTAGGGTGG + Intergenic
1090633526 11:128671316-128671338 AACTCCTTTGAGCCTGTGTCTGG + Intergenic
1090722270 11:129487048-129487070 AAGCCCTTTGAATCTTTAGGTGG - Intergenic
1091139232 11:133221130-133221152 AGCACTTTTGAGTCTTTGGCTGG + Intronic
1091387805 12:105671-105693 AAGTACTTTGACACTTTGGGAGG + Intronic
1091943930 12:4517378-4517400 AACTCTTTTGAGTGTTAGAGAGG - Intronic
1092756938 12:11772529-11772551 AACTCCTTAGAAATTTTGGGTGG - Intronic
1093698131 12:22186054-22186076 AATTCCTTTGTGTGTGTGGGTGG - Intronic
1097789558 12:63800261-63800283 AACTCCTCAGAGTTGTTGGGGGG + Intronic
1099533290 12:83814670-83814692 AACTTATTTGAGTCTATGTGGGG + Intergenic
1100656783 12:96655201-96655223 AACTGCTTTGAATCCTTTGGTGG - Intronic
1102784961 12:115597082-115597104 AATTCCTTTGTGTGTTTTGGAGG - Intergenic
1107646413 13:42498661-42498683 AACTCCTTTGGGTGTTTTGAAGG - Intergenic
1112822630 13:103354468-103354490 TTCTCCTTTGAGTCACTGGGTGG - Intergenic
1113172800 13:107524635-107524657 AAGTGCTTTGAGGCTTTGGGAGG - Intronic
1113705482 13:112429523-112429545 AACCCATTTGTGTCTTTAGGGGG + Intronic
1114001046 14:18246597-18246619 AACTGCTTTGAGGCCTAGGGTGG - Intergenic
1115532569 14:34340849-34340871 CTCTCCTTTGAGTCTTTTGCAGG - Intronic
1117590123 14:57258852-57258874 AGCTTCTTTGAGTTTTTGGGTGG - Intronic
1118417306 14:65555452-65555474 AGATCCTTTAAGTCTTTGGCAGG - Intronic
1120342024 14:83233389-83233411 GAATCCTGTGAGTCTTTGTGTGG + Intergenic
1121981290 14:98456772-98456794 AACTCTTTGGAGTCTTTGCAAGG + Intergenic
1124913493 15:33946153-33946175 TACTTATTTGAGTATTTGGGAGG - Intronic
1126582961 15:50257906-50257928 AACTCCTATGGGTGTGTGGGTGG - Intronic
1134081670 16:11328924-11328946 AACTGCTTTGGGGCTTTGGCAGG + Intronic
1134846687 16:17446714-17446736 AAATCTTTTGAGTCTTTAGAAGG - Intronic
1138401421 16:56747917-56747939 ACCTGCTTTGAGTCTGTGGAAGG + Intronic
1144118428 17:12125044-12125066 AATGCTTTTGAGTCTTTGAGGGG + Intronic
1148914192 17:50960704-50960726 AACTCCTTTATGTCTGTGGGTGG + Intergenic
1149785487 17:59431082-59431104 AACTAGTTTCAGTATTTGGGTGG + Intergenic
1150149228 17:62795527-62795549 TACTCCTTTCAGTGGTTGGGTGG - Intronic
1153808854 18:8734253-8734275 AACTCCGTTGAAGCTTTGGAGGG + Intronic
1156206699 18:34894236-34894258 AACTCCCTTGAGGCTTTTAGAGG - Intergenic
1159314194 18:66749970-66749992 AACTCCATTTGATCTTTGGGAGG + Intergenic
1162844677 19:13383014-13383036 AACTCCTGTGACTAGTTGGGCGG + Intronic
1166120466 19:40683330-40683352 AACTCCCTTCAGTCATTGTGGGG - Intronic
1166399984 19:42471496-42471518 AAATGCTTTGTGTTTTTGGGGGG - Intergenic
1167433265 19:49465132-49465154 TGCTCCCTTGAGTCTCTGGGGGG - Intronic
1168525290 19:57083808-57083830 AACTGCTTTGAGGCTATGGACGG + Intergenic
927715541 2:25349658-25349680 AGCAGCTTTGGGTCTTTGGGGGG - Intergenic
931096621 2:58947753-58947775 AAATCCTTTGAATCCTGGGGTGG - Intergenic
932043521 2:68324139-68324161 AAATCCTTTGGGTCTAAGGGAGG - Intergenic
934187039 2:89756383-89756405 AACTGATGTGATTCTTTGGGGGG + Intergenic
934309595 2:91851542-91851564 AACTGGTGTGATTCTTTGGGGGG - Intergenic
936590497 2:113799177-113799199 ATTTCCTTTCAGTCTTTTGGGGG - Intergenic
937144113 2:119627763-119627785 AACTCGTTGGAGTCCTGGGGTGG - Exonic
943591499 2:189803164-189803186 AAGCCTTTTGAGTTTTTGGGGGG - Intronic
946866201 2:224043205-224043227 ATCACCTTTGAGTCCTTGGCAGG + Intergenic
947710897 2:232315098-232315120 AACTCCTTGAAGTCTTGGGAAGG - Intronic
1168856768 20:1014145-1014167 AACCCCTTTGGCTCCTTGGGAGG - Intergenic
1169052294 20:2590746-2590768 AAATCATTGGAGTTTTTGGGGGG - Intronic
1174011897 20:47456360-47456382 ATTTCTTATGAGTCTTTGGGTGG + Intergenic
1180425558 22:15177395-15177417 AACTGCTTTGAGGCCTAGGGTGG - Intergenic
1180536690 22:16398681-16398703 AACTGGTGTGATTCTTTGGGGGG - Intergenic
1181287428 22:21764117-21764139 GACTCCTTTGAGCCGTTTGGAGG - Exonic
1181660849 22:24347638-24347660 AACTCTTTGGAGCCCTTGGGAGG + Intronic
949394569 3:3601086-3601108 AATTCCTTGGAGTGTCTGGGAGG - Intergenic
950880447 3:16318742-16318764 AACTCATTTGGGTTTTTTGGGGG - Intronic
954075247 3:48173675-48173697 AACTCCATTGACACCTTGGGTGG - Intronic
954377989 3:50205056-50205078 GACTCCGTTGAGTCTTGTGGGGG - Intergenic
954472185 3:50707586-50707608 AACTGCGGTGAGTCTTTGGTGGG + Intronic
958389088 3:93434488-93434510 ACCTCCTTTGAGGCTTTCGTTGG + Intergenic
960703244 3:120457719-120457741 AAATCCATTTATTCTTTGGGAGG - Intergenic
965203253 3:165688215-165688237 AACTCCTTTCAACTTTTGGGGGG - Intergenic
965249870 3:166329080-166329102 CACTCCTATGAGTGTTTGTGTGG - Intergenic
966217767 3:177520368-177520390 AAGTCCTTTGAGTCTCTGTTTGG - Intergenic
967512325 3:190325994-190326016 AGCTCCTTGGAGTCTTTGAGAGG + Intronic
968005401 3:195239223-195239245 AACCTGTTTTAGTCTTTGGGAGG - Intronic
968285661 3:197507219-197507241 AACTCACTTGAGTAGTTGGGAGG + Intergenic
971606309 4:28662538-28662560 AAGTCCTTTGTGACTCTGGGAGG + Intergenic
973071553 4:45866126-45866148 ACCTACTCTGAGGCTTTGGGTGG - Intergenic
973138653 4:46738008-46738030 AAAACCTTGGTGTCTTTGGGTGG - Intronic
974640435 4:64623734-64623756 AATACTTTTGAGTATTTGGGAGG - Intergenic
981270003 4:142834822-142834844 AACTCCCTTGAGGTTTTGAGGGG + Intronic
981699147 4:147589513-147589535 AACCCCTTTTAGGATTTGGGTGG - Intergenic
983429294 4:167627962-167627984 TAATCCTTTGACTCTTTGGTTGG + Intergenic
984300486 4:177911449-177911471 AATTCCTTTGAGTGTATTGGTGG - Intronic
988411757 5:30894947-30894969 ATCTCTTGTGAGTCTTTGTGTGG + Intergenic
990120270 5:52442655-52442677 AACTGCTTTGAGGCTTGAGGAGG + Intergenic
990687537 5:58322991-58323013 AACTGCTTTGAGTCTTTGGGAGG + Intergenic
999188307 5:149729220-149729242 AACTCATTGGAGTTTTTTGGGGG + Intergenic
999933647 5:156461341-156461363 AACTCCTTTGAGTATATGATGGG - Intronic
1001800585 5:174540538-174540560 TACTCCTTTTAGTTTTTGGGGGG - Intergenic
1003991140 6:11487779-11487801 AACTCTCTGGTGTCTTTGGGGGG + Intergenic
1004008421 6:11658028-11658050 AAGTCCTGTAAGTCTTTTGGTGG + Intergenic
1006081213 6:31567989-31568011 ATCCTCTTTGAGTGTTTGGGTGG - Intergenic
1008786813 6:55177818-55177840 AACTGCTTTCCATCTTTGGGAGG - Intronic
1008933169 6:56961337-56961359 ATCTCCATTTAGTCTTTGGGTGG - Intronic
1011998421 6:93622563-93622585 AAAGCCTTTGAGTCTTTAGTTGG - Intergenic
1015492328 6:133839739-133839761 AACACCTTTTATTTTTTGGGGGG + Intergenic
1019077867 6:169404899-169404921 AACTCCTTTGAAACTGTGCGAGG - Intergenic
1019881607 7:3866124-3866146 AAGTCCTTTCAGTTCTTGGGAGG + Intronic
1020584139 7:10044829-10044851 AATTATTTTGAGACTTTGGGGGG - Intergenic
1020699494 7:11461894-11461916 AACTCCATTGAGCCTGTGGAAGG + Intronic
1022290202 7:28994404-28994426 ACCTTCCTTGAGTTTTTGGGAGG + Intergenic
1022973305 7:35536345-35536367 AGCTCCTGTGTGTCTTGGGGTGG - Intergenic
1023114031 7:36842835-36842857 AACTCTTCTGAGTGTTTGAGAGG - Intergenic
1024822158 7:53344424-53344446 AGCTCCTTTGAGTCAATGAGTGG + Intergenic
1026369460 7:69684137-69684159 AACAGCTTTGTGTCTTGGGGAGG + Intronic
1031249926 7:119366961-119366983 AACTCCATGGATTCTTTGGGTGG - Intergenic
1037245652 8:16831551-16831573 ATTTCCTTTGCGTTTTTGGGAGG - Intergenic
1037896531 8:22660103-22660125 AAATCCTTTCACTATTTGGGGGG - Intronic
1039895135 8:41711861-41711883 AACTCCATAAAGTCTTTTGGAGG - Intronic
1041954600 8:63543487-63543509 AACCACTTTGATTTTTTGGGGGG + Intergenic
1042395897 8:68292172-68292194 AACTCATTCAAGTCTTTGTGTGG + Intergenic
1044512030 8:93092894-93092916 ATCTCATTTGAGGCTTGGGGTGG - Intergenic
1051327078 9:15983601-15983623 AATGCCTGTGAGACTTTGGGAGG - Intronic
1051438936 9:17062391-17062413 AAATACGTGGAGTCTTTGGGAGG + Intergenic
1053388640 9:37716658-37716680 TATTCCTTTGAGTCTTTGGGGGG + Intronic
1055316072 9:75035838-75035860 AAATCCTTTCAGTCTCTGGAAGG + Intergenic
1056819523 9:89828513-89828535 ATTTCCTTTGGGTCTCTGGGAGG + Intergenic
1061767434 9:132890312-132890334 AACTCCTTTGAGACTAAGGCTGG - Intergenic
1185460109 X:329403-329425 CTCTCCCTTGAGTCCTTGGGTGG + Intergenic
1188373273 X:29395172-29395194 AACTCCTTTGAGTCTCAGGTGGG - Intronic
1190170721 X:48109723-48109745 AGCAGCCTTGAGTCTTTGGGAGG - Intergenic
1190176851 X:48157674-48157696 AGCAGCCTTGAGTCTTTGGGAGG - Intergenic
1190186988 X:48243905-48243927 AGCAGCCTTGAGTCTTTGGGAGG + Intronic
1190188597 X:48256978-48257000 AGCAGCCTTGAGTCTTTGGGAGG - Intronic
1190191083 X:48277828-48277850 AGCAGCCTTGAGTCTTTGGGAGG + Intergenic
1190194440 X:48305097-48305119 AGCAGCCTTGAGTCTTTGGGAGG + Intergenic
1190200321 X:48355497-48355519 AGCAGCCTTGAGTCTTTGGGAGG + Intronic
1190657484 X:52624734-52624756 AGCAGCCTTGAGTCTTTGGGAGG - Intergenic
1190660948 X:52653722-52653744 AGCAGCCTTGAGTCTTTGGGAGG + Intronic
1190667135 X:52705999-52706021 AGCAGCCTTGAGTCTTTGGGAGG + Intronic
1190672283 X:52752409-52752431 AGCAGCCTTGAGTCTTTGGGAGG - Intronic
1191110214 X:56798548-56798570 AACTACCTAGAGCCTTTGGGAGG + Intergenic
1191673026 X:63766598-63766620 AAGTCCTTTGAGTGTTTGTGAGG - Intronic
1192574573 X:72232844-72232866 AACTGATTTGACACTTTGGGAGG + Intronic
1196120123 X:112041051-112041073 GACTCCTATCAGTCTTTGGTTGG + Intronic
1196340929 X:114596608-114596630 AACTCCTTTGAGTCTTTGGGGGG + Intronic