ID: 1196343125

View in Genome Browser
Species Human (GRCh38)
Location X:114620307-114620329
Sequence AACCTCGTGCTGCATGAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 62}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196343125 Original CRISPR AACCTCGTGCTGCATGAAAC AGG (reversed) Intronic
905107626 1:35573803-35573825 AACCTCGGGCCCCAAGAAACGGG + Intronic
905839379 1:41162084-41162106 GACCTCCTGCTCCATGGAACAGG + Intronic
1064952819 10:20873063-20873085 AACCTAGTGTTACAGGAAACGGG - Intronic
1066458742 10:35595093-35595115 AACCTCGTCCTGAATCAAAGTGG + Intergenic
1070591539 10:77805408-77805430 TTCCTCCTGCTGCCTGAAACAGG + Intronic
1071501300 10:86206207-86206229 AACCTCGAGCTTCATGAGTCAGG - Intronic
1071797748 10:89024332-89024354 TAACTCGTTCTGCATGAAAAAGG + Intergenic
1074736765 10:116443033-116443055 AATCTCTTTCTGCTTGAAACAGG + Exonic
1083200077 11:61115736-61115758 AACATCGTGCTGAATGTACCTGG + Intronic
1083705341 11:64510349-64510371 AACATACAGCTGCATGAAACAGG - Intergenic
1085124617 11:73991424-73991446 AGCCTTGTCCAGCATGAAACTGG + Intergenic
1085566347 11:77517564-77517586 AACATCGTCTTCCATGAAACCGG - Intronic
1091439320 12:500460-500482 AGCCTAGTCCTGCATGTAACAGG + Intronic
1097260220 12:57715554-57715576 AACTTCGTGCCTCAAGAAACAGG - Intronic
1101398951 12:104371989-104372011 AAAATCGTCCTCCATGAAACCGG - Intergenic
1105041747 12:132966662-132966684 AGCCTCTGGCTCCATGAAACAGG + Intergenic
1106469059 13:30038684-30038706 AACCTAGTGCCAAATGAAACAGG - Intergenic
1114336745 14:21698280-21698302 AACCCCGTGCTCTCTGAAACAGG + Intergenic
1117360722 14:54971031-54971053 AACCACATGCAGAATGAAACTGG + Intronic
1120245696 14:82003677-82003699 AACATCCTGCTGGATGTAACTGG + Intergenic
1133597471 16:7306663-7306685 AACCTAATTCTGAATGAAACAGG - Intronic
1139552336 16:67681358-67681380 CACCTCTTGAGGCATGAAACAGG - Intronic
1144139425 17:12334099-12334121 AACCTGCTCCTGAATGAAACTGG - Intergenic
1151383123 17:73739155-73739177 AACCTGGTTCTGCTTGAAGCCGG + Intergenic
1157570367 18:48708464-48708486 AACCTCCTCCTGCATGCAATGGG - Intronic
1163865604 19:19770523-19770545 AACCCCGTGCTCTCTGAAACAGG + Intergenic
1165473748 19:36017771-36017793 ACCCTCGTGCTGCAGGTTACTGG - Exonic
1166912241 19:46167340-46167362 AGCCCCTTGCTGCATGATACTGG + Intergenic
929231890 2:39568601-39568623 AATCTAGGGCTGCATTAAACTGG - Intergenic
930041635 2:47129550-47129572 AACACCGTGCTGCCTGTAACAGG - Intronic
930880775 2:56267640-56267662 GCCCTCATGCAGCATGAAACTGG + Intronic
936091652 2:109505268-109505290 AACCACGTGTTTCTTGAAACAGG + Intergenic
941752266 2:169145623-169145645 AATCTCTTGGTGCATGAAAGGGG - Intronic
945616313 2:212072809-212072831 AATCTCAAGCTCCATGAAACAGG - Intronic
1171451308 20:25237822-25237844 AACCTCCCGCTGCATGCAACTGG - Intergenic
1174745501 20:53057967-53057989 AAAATCGTCCTCCATGAAACTGG - Intronic
1175044971 20:56096351-56096373 AACCTCTTCCTGTATGAAAGAGG - Intergenic
1177584791 21:23076892-23076914 AATCTCTTATTGCATGAAACTGG - Intergenic
1179357477 21:40674037-40674059 ACATTCGTGCTGCATGGAACTGG + Intronic
1183000366 22:34852253-34852275 CACCTCTTCCTGCAGGAAACTGG + Intergenic
1184372731 22:44092930-44092952 TACCTCTTTCTCCATGAAACAGG - Intronic
950679434 3:14574862-14574884 AACATCATGCTGAATGAAAAGGG + Intergenic
959069836 3:101692028-101692050 AACCCCGTGCTCTCTGAAACAGG + Intergenic
959070739 3:101700182-101700204 AACCCCGTGCTCTCTGAAACAGG + Intergenic
959985314 3:112564890-112564912 AACCCTGTGCTCCCTGAAACAGG - Intronic
964884113 3:161460675-161460697 AACATCATACTGAATGAAACTGG - Intergenic
969882279 4:10184815-10184837 AGGCTTGTGCAGCATGAAACTGG + Intergenic
979573218 4:122254252-122254274 AACTTCATGCTACATGAATCTGG - Exonic
987016851 5:13829040-13829062 AACCTCATGATGCCTGAACCTGG + Intronic
1001946869 5:175786585-175786607 AACCAAGGGCAGCATGAAACAGG - Intergenic
1007792255 6:44317160-44317182 AACCCCGTGCTCTCTGAAACAGG + Intronic
1009876554 6:69512669-69512691 AACCTCTTTCTGCATGAAAATGG + Intergenic
1018816065 6:167332222-167332244 AACCCCGTGCTGTAACAAACAGG - Intronic
1023950965 7:44844775-44844797 AACCTATTTCTGCATGAAAAAGG + Intronic
1029695009 7:102206912-102206934 ACCCTCGTCCTACATAAAACAGG + Intronic
1032823098 7:135542918-135542940 ATCCTCGGGCTGCAGGAGACAGG + Intergenic
1033294235 7:140115498-140115520 AACCCCGTGCTCTCTGAAACAGG + Intronic
1041201466 8:55454459-55454481 AACCTCGTGCTCCATGAGGGTGG + Intronic
1052749099 9:32470668-32470690 AACCTGCTTCTTCATGAAACAGG + Intronic
1058091747 9:100813713-100813735 AGCCTCCTGCTCCATGGAACAGG - Intergenic
1060612945 9:124985072-124985094 AAACTCGCCCTGCATTAAACTGG + Intronic
1195719209 X:107849884-107849906 AACCTCTTGCAGCAGGAAATGGG + Intronic
1196343125 X:114620307-114620329 AACCTCGTGCTGCATGAAACAGG - Intronic
1201440218 Y:14000682-14000704 AACCCCGTGCTCTCTGAAACAGG - Intergenic
1201444353 Y:14042026-14042048 AACCCCGTGCTCTCTGAAACAGG + Intergenic