ID: 1196345624

View in Genome Browser
Species Human (GRCh38)
Location X:114653645-114653667
Sequence ATGAACAAGGAGAAACAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 749
Summary {0: 1, 1: 1, 2: 3, 3: 74, 4: 670}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196345624_1196345629 13 Left 1196345624 X:114653645-114653667 CCCTCCTGTTTCTCCTTGTTCAT 0: 1
1: 1
2: 3
3: 74
4: 670
Right 1196345629 X:114653681-114653703 TAAGTGTACAAGGATTATGCAGG 0: 1
1: 0
2: 1
3: 2
4: 109
1196345624_1196345628 3 Left 1196345624 X:114653645-114653667 CCCTCCTGTTTCTCCTTGTTCAT 0: 1
1: 1
2: 3
3: 74
4: 670
Right 1196345628 X:114653671-114653693 TCTTCTTTATTAAGTGTACAAGG 0: 1
1: 0
2: 1
3: 13
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196345624 Original CRISPR ATGAACAAGGAGAAACAGGA GGG (reversed) Intronic
900423021 1:2563853-2563875 CTGAACAAGGAGTTCCAGGATGG + Intronic
902726702 1:18340959-18340981 AAGAAGAAGGAGAAGAAGGAGGG - Intronic
902908465 1:19577105-19577127 ATGAACAAGGAGTAGCAGAGTGG - Intergenic
903404867 1:23087903-23087925 ATGGAGAAGGAGGAACAGGAGGG + Exonic
903478428 1:23636225-23636247 AAGAACATAGAGAAAAAGGATGG + Intronic
904141250 1:28355267-28355289 ATTAACAAGGTGAAACATGGAGG - Intergenic
905030238 1:34877475-34877497 CTGAACCAGGAGAAAGAAGAGGG + Intronic
905115020 1:35631141-35631163 ATGAACAAGTAGCAACAGGAGGG + Intronic
905454123 1:38075896-38075918 ATGTACAGGGAGAGCCAGGAGGG - Intergenic
905545499 1:38795648-38795670 AAGAACAAGGAAAAAAAGAAAGG + Intergenic
905934820 1:41815062-41815084 ATGAAGAAAGTAAAACAGGATGG + Intronic
906099981 1:43254022-43254044 ATGAGCAAGAAGAAACTGGGAGG + Intronic
906559816 1:46748261-46748283 ATGAACTTGGAGAAGTAGGATGG - Intergenic
906960430 1:50416529-50416551 ATAAAAAAGGAGAAAAAAGAGGG - Intergenic
907071085 1:51535508-51535530 ATGAAGAAATAGAAACAGTATGG - Intergenic
907456629 1:54580547-54580569 AGCAAAAAGGAGAAACAGAACGG - Intronic
908862608 1:68506691-68506713 ATGACCAAAGAGAAGCAGAAAGG + Intergenic
910433842 1:87185159-87185181 AAGAACAATGAGAAGCAGAAGGG - Intergenic
910501768 1:87900590-87900612 ATGAAGAAGGAGAAAGAGATGGG - Intergenic
910742122 1:90530893-90530915 ATGACCAAGCTGAAACAGAATGG - Intergenic
910919668 1:92330103-92330125 ATGAAGAATAAGAAACTGGACGG - Intronic
911319046 1:96389906-96389928 ATGAATCAGGAGAATCATGATGG - Intergenic
911357657 1:96842018-96842040 ATTAACACAAAGAAACAGGAGGG + Intergenic
911584059 1:99669810-99669832 ATTAAAAAGGAGAAGGAGGAGGG + Intronic
911658461 1:100473001-100473023 TTAAACAAGGAGAAAGTGGAAGG - Intronic
911660899 1:100500133-100500155 AGGAACAAGGACAAATAGGAAGG + Intronic
911815120 1:102339769-102339791 ATATAAATGGAGAAACAGGAGGG - Intergenic
911962400 1:104322165-104322187 ATGAAAAAGGAGACAGAGAAAGG + Intergenic
911986080 1:104624572-104624594 ATGAGAAAGTAGAAACTGGAAGG + Intergenic
913351610 1:117867390-117867412 TTGAAAAAGGAAATACAGGATGG + Exonic
913691185 1:121281407-121281429 AAGAAGAAGGAGGAAAAGGAAGG - Intronic
915865669 1:159495348-159495370 GAGAGCAAGCAGAAACAGGATGG - Intergenic
915952575 1:160199221-160199243 CTGAGCAAGGGGAAACAGGACGG + Intronic
916091294 1:161309722-161309744 AAGAACAAGCAGGAGCAGGAAGG - Intronic
916178715 1:162065270-162065292 ATGCAGAAGGAGAGACAGCACGG - Intergenic
916368192 1:164057778-164057800 ATGAATGAGAAGAAAGAGGAAGG - Intergenic
916405886 1:164497479-164497501 AGGATCAGGGAGAAACAGCAAGG + Intergenic
916490812 1:165300824-165300846 ATGAATGAGGAGAAGCAGGCAGG - Intronic
916758330 1:167794290-167794312 ATGAACAGGGTGTAACAGAAAGG - Intergenic
916987312 1:170205697-170205719 ATGAACACTGAGAAACAGAAAGG - Intergenic
917175084 1:172225114-172225136 AAGAGGAAGAAGAAACAGGAGGG - Intronic
917313592 1:173702588-173702610 AGGAAGAAGGAGAAGGAGGAAGG + Intergenic
917489516 1:175486053-175486075 ATTAACTAGGAGGTACAGGATGG + Intronic
917644311 1:177014894-177014916 AGGAAGAAAGAGAAACATGAAGG + Intronic
918083776 1:181227988-181228010 ATGAAGAAGGAGAAATGGGATGG - Intergenic
918202358 1:182279351-182279373 ATGAACTAGAAGGAACAGGAGGG + Intergenic
918287883 1:183076416-183076438 ATGAAAAATGAGAAACTTGAGGG + Intronic
919518559 1:198557653-198557675 ATGGACAGGGAGTAACATGAAGG - Intergenic
919588229 1:199465551-199465573 ATGAAGGAAGAGAGACAGGAGGG + Intergenic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
920070781 1:203301510-203301532 AGGGAGAAGGAGAAGCAGGAAGG + Intergenic
920478509 1:206299883-206299905 AAGAAGAAGGAGGAAAAGGAAGG - Intronic
920841809 1:209561700-209561722 AGGAACAATGAGACAGAGGATGG - Intergenic
921216241 1:212939020-212939042 TTGACCAATGAGAAACAAGATGG - Intergenic
921418584 1:214919808-214919830 ATGGAGAAGGAGAATCAGGAAGG - Intergenic
923357632 1:233176339-233176361 AGGAAGAAGGAGAGAAAGGAAGG - Intronic
923566502 1:235080387-235080409 ATGAAGAAAGAGAGAAAGGAAGG + Intergenic
923717047 1:236433999-236434021 ATGACCATGGAGCAACAGGATGG - Intronic
924153676 1:241154297-241154319 AGCCCCAAGGAGAAACAGGAAGG + Intronic
924745696 1:246831692-246831714 ATGGGCAAGGAAAGACAGGAAGG + Intergenic
1062864216 10:836463-836485 ATGAAAAGGGAGAAAAAGTAAGG - Exonic
1063114429 10:3063966-3063988 ATGCACAGGCAGAAACAGCAGGG + Intergenic
1063494499 10:6494406-6494428 ATGAAGAAGGTGAACCATGAAGG - Intronic
1063579265 10:7291068-7291090 ATGAACAAGGAGACCCATGCTGG + Intronic
1064364930 10:14699161-14699183 TGGAACAGGGAGAAACAGTATGG + Intronic
1064543620 10:16429647-16429669 ATGAACAAAGAGAGGAAGGATGG + Intergenic
1066224031 10:33365085-33365107 ATGAGCAAAGAGAAACTGGCTGG - Intergenic
1066617870 10:37314162-37314184 AGGTACCAGGAGAAATAGGAAGG - Intronic
1067719769 10:48719610-48719632 GTAAATGAGGAGAAACAGGAGGG + Intronic
1068934466 10:62622399-62622421 AGGGAAAAGGAGAAGCAGGATGG - Intronic
1068953450 10:62801412-62801434 ATCAACAAGGATAAAAAAGAAGG + Intergenic
1069277892 10:66615454-66615476 AAGAAGAAGGAGACACAGGAAGG + Intronic
1069362701 10:67661269-67661291 AGGAAGAAAGAGAAAAAGGAGGG + Intronic
1070320215 10:75348977-75348999 GAGAAAAAAGAGAAACAGGAAGG - Intergenic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1070714279 10:78707914-78707936 AGGAGGAAGGAGAACCAGGAAGG - Intergenic
1070744565 10:78925481-78925503 AGGGAGAAGGAGAAAAAGGAGGG + Intergenic
1072224514 10:93356030-93356052 ATAAACAGGGAGTAAAAGGATGG + Intronic
1073209170 10:101784385-101784407 ATGAAAGAGGAGAAAAGGGAGGG + Intergenic
1074125371 10:110524934-110524956 ATGAAGAAGGAGAGACAAAATGG + Intergenic
1075107548 10:119551537-119551559 ATCCACTAGGAGATACAGGAGGG + Intergenic
1075951497 10:126481715-126481737 ATGAACGGGGAGAGATAGGAGGG - Intronic
1076831868 10:132999426-132999448 ATGGAGGTGGAGAAACAGGAGGG - Intergenic
1076831894 10:132999514-132999536 ATGGAGGTGGAGAAACAGGAGGG - Intergenic
1076831920 10:132999602-132999624 ATGGAGGTGGAGAAACAGGAGGG - Intergenic
1076850946 10:133092728-133092750 ATGAAGAAGGAGAAATAGGGAGG + Intronic
1077391119 11:2301072-2301094 GAGAACCAGGAGAACCAGGAGGG - Intronic
1077563034 11:3277302-3277324 AGGAACAGGGGGAAATAGGAAGG - Intergenic
1077568925 11:3323118-3323140 AGGAACAGGGGGAAATAGGAAGG - Intergenic
1078125741 11:8561144-8561166 ATGAAGAAGCAGAGATAGGAAGG - Intronic
1078389052 11:10919510-10919532 TTCAACAAGGAGAAAAAGGCAGG - Intergenic
1078935076 11:15942667-15942689 AGGAAGAAGGAAAAACAAGATGG + Intergenic
1079150130 11:17891180-17891202 ATGAACAAGTAGAAACACATAGG + Intronic
1079237684 11:18701510-18701532 ATGAAGAATGAGTAACAGGGTGG - Intronic
1080131348 11:28798602-28798624 ATGAACAAATGGTAACAGGAAGG + Intergenic
1080487018 11:32719033-32719055 AAGAACAAGGAGATACAGCAAGG + Intronic
1080556623 11:33422784-33422806 ATGAAAAAGAAAAAAAAGGAAGG + Intergenic
1081205832 11:40274539-40274561 ATGAAAAGGGAGACAGAGGAGGG + Intronic
1081480856 11:43487500-43487522 TTTAACAAGGAGAAACAAGTTGG + Intronic
1081734888 11:45395725-45395747 ATGAACAAGGACAAAAAAGATGG + Intergenic
1081797685 11:45832787-45832809 ATGGAAATGGAGGAACAGGATGG - Intergenic
1083313839 11:61802112-61802134 GTGAACAGAGAGAACCAGGAGGG - Exonic
1084292820 11:68186226-68186248 AGGAACACTGAGAAACGGGACGG + Intronic
1084730215 11:71068190-71068212 ATCTACAAGTAGAAAGAGGAAGG + Intronic
1085646066 11:78223712-78223734 ACTAGCAAGAAGAAACAGGAAGG + Intronic
1085983131 11:81748880-81748902 ATGAAGAAGGAGAAGGAGAAGGG - Intergenic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086457073 11:86969531-86969553 AGGAAGAAGGAGAAAGGGGATGG - Intergenic
1088735612 11:112725475-112725497 ATGAACAGGGAGCAACATGGGGG + Intergenic
1089295192 11:117463157-117463179 AGGCACAAGGTGAAGCAGGAAGG + Intronic
1089413037 11:118263103-118263125 ATGAAAAAGAAGAAAAAGAAGGG + Intronic
1089849254 11:121482231-121482253 AAGAGCAAGGGGAAACTGGAGGG + Intronic
1090737541 11:129623310-129623332 AGGAACAAGTAGAAAGAGAAAGG - Intergenic
1091337143 11:134780705-134780727 GAGAAGAAGGAGAAAGAGGAGGG - Intergenic
1091363972 11:135001655-135001677 AAGAAGACGGAGAAGCAGGAAGG + Intergenic
1091439643 12:502539-502561 AAGAGAAAGGAGAAACAGGCGGG + Intronic
1091443661 12:530643-530665 ATGAAGAAACAGAAACAGAAAGG - Intronic
1091713301 12:2757992-2758014 AAAAACAAAGAGAAACAGGTGGG + Intergenic
1092171580 12:6376656-6376678 GTGAGCAAGGAGAGAGAGGAGGG + Intronic
1092678897 12:10954817-10954839 AAGATCAAGAAGAAACAGAAGGG + Intronic
1092986511 12:13850880-13850902 ATGAAGAAAGAGAATCAGAAAGG - Intronic
1094244430 12:28272600-28272622 ATGAATAAAGAGAAGGAGGAAGG - Intronic
1094394861 12:29994778-29994800 ATGAACAAGGAAAAAGTTGATGG + Intergenic
1094498127 12:31001984-31002006 AAGAACAAGCAGAGACAGGGTGG + Intergenic
1095218465 12:39578583-39578605 ATGAATCAGGAGAATCAGAAGGG + Intronic
1095537063 12:43261698-43261720 ATATACAAGGAGGAAGAGGAAGG + Intergenic
1095927210 12:47591140-47591162 ATGAGCAAGGAGGAAAAGGAAGG + Intergenic
1096518142 12:52169649-52169671 CTGATCATGCAGAAACAGGAAGG + Exonic
1096616944 12:52838646-52838668 AGGAAGAAGGAGGAACAAGAAGG + Intronic
1097152195 12:56987287-56987309 TTGAACAAGGACAATGAGGATGG + Intergenic
1097461096 12:59862816-59862838 ATAAACAAGGATAAACAAAATGG + Intergenic
1097729169 12:63108031-63108053 CGGAAGAAGGAGAAAGAGGAAGG - Intergenic
1098411415 12:70188379-70188401 ATAAACTAGGGGAAACAGCAGGG - Intergenic
1098528707 12:71516091-71516113 ATAAACAAGAAGAAAAAGGGAGG + Intronic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1098859824 12:75695758-75695780 ATGAGCAAGGAGAAAGGAGAAGG + Intergenic
1099007970 12:77257509-77257531 ATAAACAAGGAGAAATTGAAGGG - Intergenic
1099850841 12:88094851-88094873 ATGAAGCTGGAAAAACAGGAGGG - Intronic
1099950044 12:89291825-89291847 CTGAAGAAGGAGAAAGAAGAGGG + Intergenic
1101037017 12:100716556-100716578 ATGAAGCAGGGGAAAGAGGAAGG - Intergenic
1101155259 12:101921906-101921928 ATGAGCAGGGAGAAACAAGGTGG - Exonic
1101469806 12:104986057-104986079 ATAAAAAAGGATAAAGAGGAGGG + Intergenic
1101811940 12:108115036-108115058 AGGAAGAAAGAGAAAGAGGAAGG + Intergenic
1102364739 12:112322518-112322540 ATTACGAAGGAGAAACAGGAAGG + Intronic
1102487307 12:113266940-113266962 ATGAAGAAGGAGAAACAGGAAGG - Intronic
1103000430 12:117381669-117381691 ATGAAGAAAGAAAAACAGGGAGG - Intronic
1103130552 12:118464786-118464808 TAGAACAAGGAGACACAGGAAGG + Intergenic
1103158152 12:118705389-118705411 CTGAAAAAGGAGAAACATCAAGG - Intergenic
1103235346 12:119368066-119368088 AAGAACAAGAAGAAGGAGGAGGG + Intronic
1103480856 12:121248902-121248924 ATGAAGACGGAGAGACAGGACGG + Intronic
1103662072 12:122528227-122528249 ATGAAGAAGGAGGGACAGGTTGG - Intronic
1103676995 12:122663662-122663684 ATGAAGAAAGAAAAACAGGCCGG - Intergenic
1103680663 12:122690966-122690988 AATAACAAGCAGAAAGAGGAAGG - Intergenic
1104196909 12:126549085-126549107 ATGAAGGAGGAGAAGAAGGATGG + Intergenic
1104392761 12:128404938-128404960 AAGAAAATGGATAAACAGGAAGG + Intronic
1105662949 13:22519531-22519553 ATGAAAAAGGACAAACATGAAGG + Intergenic
1105814592 13:24023129-24023151 TTGAACAATGAGACACAGGCTGG - Intronic
1106043505 13:26116444-26116466 ATGAGCAAGGAGAAAAAAAATGG + Intergenic
1106195622 13:27491718-27491740 AGGAAGAGGAAGAAACAGGAGGG + Intergenic
1106521241 13:30499476-30499498 AAGAAAAAAGAGAAACGGGAAGG - Intronic
1107436498 13:40385050-40385072 ATAAAAAAGGAAAAAAAGGAAGG - Intergenic
1108856852 13:54803260-54803282 AAGAACAGTGAGAAACAAGAGGG + Intergenic
1109185770 13:59265797-59265819 ATGAAAAAGAAAAAAAAGGAAGG - Intergenic
1109374800 13:61478244-61478266 ATTAAGAAAGAGAAACAGCAAGG - Intergenic
1109767266 13:66919018-66919040 ATGAACAGAGACATACAGGAGGG - Intronic
1109897202 13:68708757-68708779 ATGACCTAGAAGAAACAGGAAGG - Intergenic
1109918508 13:69023817-69023839 AAGAAGTAGTAGAAACAGGAAGG - Intergenic
1110081673 13:71321421-71321443 ATAAAGAAGGAGAAAGAAGATGG + Intergenic
1110930134 13:81205272-81205294 ATGGTCAAGGAGAAAAATGATGG + Intergenic
1111162067 13:84407552-84407574 AGGAACAAGGATCAACAGCAAGG + Intergenic
1111307072 13:86428487-86428509 ATGAATAAGAAGAATCAGTATGG - Intergenic
1111425582 13:88076495-88076517 AGGAACAAGGAGTAGCAAGAGGG - Intergenic
1112995406 13:105568583-105568605 ATGAGGAAGCAGAAACAGTAGGG + Intergenic
1113303876 13:109054968-109054990 AGGAAGAAGGAGGAAAAGGAGGG - Intronic
1113371359 13:109728305-109728327 ATGTACTGGGAGAAACTGGAAGG + Intergenic
1113502867 13:110792261-110792283 ATGCACATGGAGAGAGAGGAAGG + Intergenic
1114392226 14:22322368-22322390 AAGAAGAAGGAGAAAGAGAAAGG + Intergenic
1115789009 14:36857827-36857849 GTGCTCAAGGAGAAACAAGATGG - Intronic
1115945672 14:38657349-38657371 TTGTACAAGGGGAAACATGAAGG + Intergenic
1116044162 14:39722398-39722420 ATGGGCAAGGAGAATCAGGAAGG - Intergenic
1116321739 14:43475998-43476020 ATGTACACAGAGAGACAGGAAGG - Intergenic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1118731729 14:68671460-68671482 ATGAGCAAGGACAAAGAGCAGGG - Intronic
1118821751 14:69350480-69350502 AAGAGCATGAAGAAACAGGAGGG + Intronic
1118848015 14:69562738-69562760 ATGAACAAGGAGGTAGAGGAGGG + Intergenic
1119528287 14:75340754-75340776 AAGTACATTGAGAAACAGGATGG - Intergenic
1119531886 14:75367557-75367579 ATGAAGAAGGAAAAAAAGGAAGG + Intergenic
1119676892 14:76562540-76562562 AGGAAGAAGGAGAGCCAGGAGGG + Intergenic
1119925383 14:78488764-78488786 ATGAAGAAGAAGAAAGGGGAGGG + Intronic
1120385195 14:83836637-83836659 ATGAACAGGGTAAAACAGGAAGG + Intergenic
1121831385 14:97055270-97055292 ATGAAGAAGGAGAAGAAAGAAGG - Intergenic
1121861669 14:97324433-97324455 CTGAATCAGCAGAAACAGGAAGG - Intergenic
1122019040 14:98821211-98821233 ATGAACAAGGAAAAAAATGTTGG + Intergenic
1122098253 14:99386986-99387008 ATGGACAAGGGGAGACTGGAAGG + Intergenic
1122191148 14:100044755-100044777 ATGGACAGTGAGAAACAGCATGG + Intronic
1122419551 14:101566852-101566874 TTGAGCAAGGAGAGAGAGGAGGG + Intergenic
1123972417 15:25520390-25520412 AAGAACAAGGAGATAAAGAAAGG - Intergenic
1124116202 15:26845536-26845558 ACGAACAGGGAGAAACATAATGG + Intronic
1124216678 15:27813110-27813132 AGGAACAAGGAGAAAGGGGCAGG + Intronic
1124586656 15:31015870-31015892 AAGAACAAGATGAGACAGGATGG - Intronic
1124693415 15:31844606-31844628 AGGAACCAGGAGACACAGGCAGG - Intronic
1124982757 15:34580878-34580900 AGGAACATGGAGACACAGGTAGG - Intronic
1125114957 15:36079871-36079893 TTCAACCAGGAGAAACTGGAAGG + Intergenic
1125808512 15:42515935-42515957 ATGAACAGGGAGGAACAGTGAGG + Intronic
1126870577 15:52982716-52982738 AGGAAGAAGGGGAAAAAGGAAGG - Intergenic
1127052927 15:55103585-55103607 ATGAACCAGTGGAAACAGTATGG - Intergenic
1128283104 15:66413462-66413484 ATGAACAGGTAGACACAGGGAGG - Intronic
1128388751 15:67168652-67168674 AGGCACAAGGAGGAAGAGGAGGG - Intronic
1128839685 15:70840168-70840190 ATGAAAAAGGAGATGCAAGATGG + Intronic
1128937628 15:71760893-71760915 ATCAACAATAAGAAACAAGATGG - Intronic
1129651809 15:77496439-77496461 ATGGAAAAGGAGAAACTGGATGG - Intergenic
1130288306 15:82573403-82573425 GTGAACATAGAGAAGCAGGAGGG - Intronic
1130306090 15:82712963-82712985 ATGGGCCAGGAGAAAAAGGAAGG - Intergenic
1130424969 15:83787826-83787848 TTGAGAAAGGAGAAAGAGGAGGG - Intronic
1130532802 15:84760298-84760320 ATGAACAAGAAGGAAGAGAAAGG - Intronic
1130795137 15:87199860-87199882 AAGAAAAAGAAGAAAGAGGAAGG + Intergenic
1131262957 15:90898249-90898271 AGGAACAAGGACAACCAGGAGGG + Intergenic
1131439286 15:92446872-92446894 GTGAGCAAGGAGAAAGGGGAAGG + Intronic
1132878323 16:2149923-2149945 ATGACCTAGGACAAGCAGGAGGG - Exonic
1133592056 16:7254810-7254832 ATGAACAAGAAGAAAAAGACTGG + Intronic
1133834940 16:9359506-9359528 GTGAGAAAGGTGAAACAGGAGGG - Intergenic
1134611240 16:15610189-15610211 TTGAACAAAAATAAACAGGAGGG + Intronic
1135604843 16:23814568-23814590 AGGGACAAGGAGATAGAGGAAGG - Intergenic
1135946809 16:26872450-26872472 ATAAATTAGGAGAGACAGGAAGG + Intergenic
1136006593 16:27334578-27334600 ATGAATAAAGAGAAACAGAGAGG - Intronic
1136030778 16:27501306-27501328 ATGGATCAGGAGAAGCAGGAAGG - Exonic
1136240078 16:28938157-28938179 AAGAAAAAGAAGAAACTGGAGGG - Intronic
1136776200 16:32873108-32873130 ATGGACAAGAAGAAAGAGTAAGG + Intergenic
1136894415 16:33988404-33988426 ATGGACAAGAAGAAAGAGTAAGG - Intergenic
1137557141 16:49477641-49477663 AAGAAGAAGGAGAAGAAGGAGGG + Intergenic
1137656559 16:50164289-50164311 AAGAACAACAACAAACAGGATGG - Intronic
1138041946 16:53680840-53680862 AGGGAGAAGGAGAAATAGGAGGG + Intronic
1138751765 16:59430905-59430927 ATGAACAGGCAGCAAGAGGATGG - Intergenic
1139130064 16:64132315-64132337 CTCACCAAGGAGAAACAGGGAGG + Intergenic
1139144767 16:64310036-64310058 ATGAAGAAAGAGAAGAAGGAAGG + Intergenic
1140067429 16:71623795-71623817 GTAAACAAGCAGACACAGGATGG - Intergenic
1140382630 16:74504235-74504257 AGGGCCAAGGAGAGACAGGAGGG + Intronic
1140513107 16:75522408-75522430 AATAAAAAGGAGAAAAAGGAAGG - Intergenic
1141058560 16:80842131-80842153 ATTAACAAGGAGAAAACAGAAGG + Intergenic
1141147078 16:81538481-81538503 AAGAACATGGAGACACAGGCTGG - Intronic
1141263073 16:82471333-82471355 AAGGAGAAGGAGAAACAGAAGGG - Intergenic
1141320638 16:83005334-83005356 ATGAACAGGGAGAAAGAGTGAGG - Intronic
1141585609 16:85031583-85031605 ATGAAGCTGGAGAAACAGGCAGG - Intronic
1141656825 16:85421145-85421167 TTAAACCAAGAGAAACAGGAAGG + Intergenic
1141727830 16:85801154-85801176 ATGAATAAGGACAAACAGCAAGG - Intronic
1141775829 16:86121976-86121998 AGGGACAAGGAGAAGGAGGAGGG - Intergenic
1141867037 16:86757475-86757497 AAGAAAAATGAGAACCAGGAAGG + Intergenic
1203078615 16_KI270728v1_random:1135217-1135239 ATGGACAAGAAGAAAGAGTAAGG + Intergenic
1142795039 17:2301138-2301160 GTAAAAAAGGAGAAAAAGGAGGG + Intronic
1142799278 17:2335330-2335352 TGGATCAAGGAGGAACAGGATGG + Exonic
1143148470 17:4791371-4791393 ATGATGAAAGAGAAACAGAAGGG - Intergenic
1143365334 17:6404643-6404665 ATGAAAAAAGAAAAACAAGATGG + Intronic
1143448774 17:7023507-7023529 ATGAACAAGAAGAATTAGGAGGG + Intronic
1143890031 17:10095943-10095965 AGGAATGAGGAGGAACAGGAAGG - Intronic
1144101213 17:11943779-11943801 ATAAGGAAGGAGAGACAGGAGGG + Intronic
1145049191 17:19646555-19646577 ATGAAAAAGAAAAAACAGGCCGG - Intergenic
1147256467 17:39185008-39185030 ATGGCCAGGGAGAACCAGGAAGG + Intronic
1147343729 17:39772581-39772603 GAGAACAAGAAGAAACAGGAAGG + Intronic
1147517686 17:41137188-41137210 ATAAACAAAGAGATACTGGATGG - Intergenic
1149797932 17:59538565-59538587 AAGAATAAGGAGAAAGAAGAAGG - Intergenic
1150319444 17:64199888-64199910 ATGCACAAGAAGAGAAAGGAAGG - Intronic
1150367709 17:64604977-64604999 TTGGACAAGGAGAAAAGGGAGGG - Intronic
1150603560 17:66671638-66671660 ATAAACACTGAGAAAAAGGATGG + Intronic
1150977233 17:70102184-70102206 GTGAACAAGAAGAAAGAAGAAGG - Intronic
1151360582 17:73586276-73586298 ATAAATAAAGAGCAACAGGAGGG - Intronic
1151542644 17:74772547-74772569 ATGAAGGAGCAGAAACAGGAGGG + Intronic
1153177051 18:2387820-2387842 ATGAAGAAGCAGAAAAAAGAAGG + Intergenic
1153359879 18:4182231-4182253 AAGAACAAGCAGAAGCAGGAAGG + Intronic
1153572873 18:6491102-6491124 AAGAAGGAGGAGGAACAGGAAGG - Intergenic
1153645609 18:7193401-7193423 AAGAAAAAAAAGAAACAGGATGG - Intergenic
1154384853 18:13884025-13884047 ACTAACAGGGAGAAAGAGGAGGG + Exonic
1155712406 18:28899458-28899480 AAGAAGAAAGAGAAAAAGGAAGG - Intergenic
1155865799 18:30963426-30963448 AGGAACCAGCAGAAGCAGGAAGG - Intergenic
1155872668 18:31046675-31046697 ATTAACAAGGAGATACTGGAAGG - Intergenic
1155923565 18:31630013-31630035 GTGGAGAAGGAGAAGCAGGAAGG + Intronic
1156685585 18:39641634-39641656 AAGTACAAGGAGTAACAGGACGG + Intergenic
1156959744 18:43011208-43011230 GTGATCAAGGAGGAGCAGGAAGG + Intronic
1156989679 18:43393905-43393927 ATGAACTTGAAGAAACAAGAAGG + Intergenic
1157115258 18:44856449-44856471 AACAACAATGAAAAACAGGAAGG - Intronic
1157771908 18:50356397-50356419 GTGAAGAAAGAGAAACATGAGGG - Intergenic
1157879137 18:51303471-51303493 ATGTTCAAGGAACAACAGGAAGG + Intergenic
1158087510 18:53670066-53670088 AAGAAAAAGGACAAAAAGGAGGG - Intergenic
1158610127 18:58932175-58932197 AAGCACAAGGAGAAAGAGGGAGG - Intronic
1158875054 18:61725556-61725578 ATGAACAAGAAGACCAAGGATGG - Intergenic
1159479259 18:68966642-68966664 ATTAACAATGAGATACAGCAGGG - Intronic
1159733018 18:72055352-72055374 ATGAACAAGGAAAGTGAGGAAGG - Intergenic
1159924692 18:74257521-74257543 ATGAACAAGGAGAAAGAATATGG + Intronic
1160947440 19:1650311-1650333 ATGGACAGGGAGAAACAGGGAGG + Intronic
1162059989 19:8088779-8088801 ATGAGCAAGGAGACAAATGAAGG + Intronic
1162448816 19:10741949-10741971 AAGAACAAGAACAAAAAGGAAGG - Intronic
1162815817 19:13193778-13193800 AAGAAGAAAGAGAAAAAGGAAGG - Intergenic
1163292055 19:16385296-16385318 CTGAACCAGGAGACTCAGGAAGG + Intronic
1163912233 19:20206520-20206542 TTGAAGAAGTAGAATCAGGAAGG + Intergenic
1164054841 19:21613976-21613998 ATGAACAAGAAAAGACCGGAGGG + Intergenic
1164243881 19:23414148-23414170 ATGAACAAGAAAAGACCGGAGGG + Intergenic
1165705181 19:37970905-37970927 AGGAACAGGGAGCAACAAGACGG - Intronic
1166348431 19:42181447-42181469 ATGAACAGGCAGAATGAGGAGGG - Intronic
1166885769 19:45960177-45960199 AGGAAAAAAGAGACACAGGAAGG + Intronic
1167218857 19:48184117-48184139 ATCATCAAGGAGAAAAAGGCCGG + Intronic
1167806393 19:51789262-51789284 ATCAAAAAGGAGAAATAGGAAGG + Intronic
1168250008 19:55136628-55136650 GAGAACATGGAGAAACAGGCGGG + Intronic
925130731 2:1492487-1492509 ATGGACAAAGTGAAAGAGGAAGG - Intronic
925485274 2:4321860-4321882 GAGAACAAGGAGAAAAAGGAAGG - Intergenic
925536041 2:4917777-4917799 AGGGAGAAGGAGAAACAGAAAGG - Intergenic
926574461 2:14564705-14564727 CTCAAGAAGAAGAAACAGGAGGG + Intergenic
927207804 2:20621083-20621105 ATGAACAGGAAGAACCAGGCAGG + Intronic
927360970 2:22232990-22233012 ATGAAAAAGCAGAAACAGAAAGG + Intergenic
927733395 2:25496281-25496303 ATGAACAAGGAGAACAAGGAAGG - Intronic
927937584 2:27084316-27084338 ATGAACAGGGAGAAGATGGATGG - Intronic
928157849 2:28893275-28893297 ATAAATCTGGAGAAACAGGAGGG + Intergenic
928710906 2:34004585-34004607 ATTAAAAAGGAGATACAGAATGG - Intergenic
929013362 2:37470160-37470182 AAGACCAACGAGAAATAGGAAGG - Intergenic
929984250 2:46710840-46710862 ACGGAAAAGGAGAAACAGCAAGG - Intronic
930058588 2:47270783-47270805 ATTAACAAGGAGAAACAAACAGG + Intergenic
931255383 2:60567655-60567677 ATGCAAAAGGAAAAAGAGGAGGG + Intergenic
931338556 2:61375471-61375493 ATCAAAAAGTAGAAACAGGCGGG + Intronic
931511149 2:62996618-62996640 GTTAACAAGAACAAACAGGAAGG - Intronic
931746358 2:65294874-65294896 AGGAACAAGGAGGCACACGAGGG + Intergenic
931773567 2:65520189-65520211 ATGTACAAGCAAGAACAGGAGGG + Intergenic
931794765 2:65698782-65698804 AGGAAAAATGAGAAAAAGGAGGG - Intergenic
931852956 2:66271665-66271687 GAGAGAAAGGAGAAACAGGAGGG + Intergenic
932082826 2:68731216-68731238 AGGAACAAGGAGAAAACGGTGGG - Intronic
932133811 2:69211126-69211148 TTAAACAAGGAGAAACAGGGAGG + Intronic
932625866 2:73295354-73295376 ATGAACATTGAGAAACTGAATGG - Intergenic
933197860 2:79412780-79412802 ATTGAGAAGGAGAAACTGGATGG + Intronic
933260030 2:80122197-80122219 AGAAATAGGGAGAAACAGGACGG - Intronic
933306183 2:80601981-80602003 ACGCACAGAGAGAAACAGGATGG - Intronic
933789208 2:85870422-85870444 ATGAAAAAGGAGAACGAGGAGGG - Intronic
933889044 2:86748884-86748906 ATGAATAAGTAGAAACCTGAAGG + Intronic
934571102 2:95373970-95373992 CTGAACAAGGGGATATAGGAGGG - Intronic
934723603 2:96600590-96600612 AAGGACAGGGAGACACAGGAAGG + Intronic
934874912 2:97908571-97908593 ATGAGCAAGGGGAAAGAGGAGGG + Intronic
935177721 2:100664188-100664210 AGGAGCAAGGAGACACAGAAGGG + Intergenic
935416066 2:102820745-102820767 ATGAAGTTGGAGAAGCAGGAAGG + Intronic
936376908 2:111948615-111948637 ATGAAAAATGAGAAAAAGGAAGG - Intronic
937323073 2:120972491-120972513 ATCACCCAGGAGAATCAGGAAGG - Intronic
937887962 2:126913235-126913257 ATGAAAAAGGAGAAGGATGATGG - Intergenic
939102035 2:137906465-137906487 ATGGACAAGGAGACACAAAAGGG + Intergenic
939229438 2:139407648-139407670 ATGAAGTAGGAGTAAAAGGAAGG + Intergenic
940164056 2:150748397-150748419 AAGAAAAAGAAGAAAGAGGAAGG - Intergenic
940712967 2:157184540-157184562 ATGGATAAGGAGAAACAGCAAGG - Intergenic
940737416 2:157469056-157469078 CTGAAGAAGGAGAAGCAGAATGG - Intronic
940797771 2:158098616-158098638 ATGAGCAAGGAGCAAGAGAAGGG - Intronic
941231967 2:162921466-162921488 AAGAAAGAGGAGAAAGAGGAAGG + Intergenic
941451594 2:165666605-165666627 ATGAAGAAAGAGAGAAAGGAAGG + Intronic
941499010 2:166245431-166245453 ATGAACAAGAAGGACCAAGAGGG + Intronic
941511063 2:166410604-166410626 AGGACAAAGGAGAAACAGCAGGG + Intronic
941558619 2:167016178-167016200 AGGAGGAAGGAGAAAAAGGAGGG - Intronic
941834927 2:170005547-170005569 ATGAACTGGGAGAAAAAGAAGGG + Intronic
941940228 2:171028875-171028897 ATGAAGAAGGCAAAAAAGGATGG + Intronic
941992822 2:171573626-171573648 ATGAAAAAGGACAAAAAGGAAGG + Intergenic
942412452 2:175725192-175725214 AACAAAAAGAAGAAACAGGAAGG + Intergenic
942745460 2:179226912-179226934 AGGAAGCAGGAGAAAAAGGAAGG + Intronic
942970270 2:181950059-181950081 ATGTGCACAGAGAAACAGGATGG + Intergenic
943434243 2:187844165-187844187 ATGAACAAGAAGAAACTGTGGGG - Intergenic
943587106 2:189754140-189754162 ATGAAAAAGGAAAAAGAGGAAGG - Exonic
943732560 2:191318237-191318259 ATGAGCCAGGAAAAACAGCAGGG + Intronic
943751854 2:191517441-191517463 ATAAACAAGGAGATAGAGGCTGG + Intergenic
943953865 2:194161848-194161870 AAGATCAAGGGGAAGCAGGAGGG - Intergenic
944285749 2:197948105-197948127 ATGAGAAATGAGAAACAGGATGG + Intronic
944453501 2:199869425-199869447 AAGAAGAAAGAGAAAAAGGAAGG - Intergenic
944758308 2:202786784-202786806 ATGAACAAGTAGAAACAATAAGG + Intronic
945431462 2:209770975-209770997 AGGAAGAAGGAGAAGGAGGAGGG + Intergenic
945656412 2:212629422-212629444 ATGAACAAGAAGGAAAAGAAGGG - Intergenic
946377639 2:219322661-219322683 ATGAAAAGAGCGAAACAGGAGGG - Intergenic
947311659 2:228809614-228809636 AAGAGCAAGCAGAAACAGGGTGG - Intergenic
947929441 2:233951461-233951483 TTGTACAAGGAGTAAGAGGAAGG - Intronic
947971844 2:234331463-234331485 ATGAACCTGGGGACACAGGAGGG - Intergenic
1168838089 20:891131-891153 ATGAAAAAGGGGAAACAGCAAGG + Intronic
1169284656 20:4297846-4297868 CTGAACAAGGAGAAAAAGTCAGG - Intergenic
1169472050 20:5894938-5894960 ATGAATAAGGAAAAAGAGGTGGG - Intergenic
1169979708 20:11370712-11370734 ATGGGCAAGAAGAAAAAGGATGG + Intergenic
1170118719 20:12889160-12889182 ATGAACAAGGAGTACCAAAAAGG + Intergenic
1170976995 20:21174028-21174050 AAGAACGAGGAGAACCAGGAGGG + Intronic
1171093127 20:22305024-22305046 ATGGAAAAGAAGAAAGAGGAAGG - Intergenic
1171177978 20:23068386-23068408 ATGGGCAAAGAGAAACAAGAGGG + Intergenic
1173421903 20:42908859-42908881 ATACACAAGGAAATACAGGATGG + Intronic
1174501340 20:50987259-50987281 AGGAAGAATGAGAAACAGGCAGG + Intergenic
1174835392 20:53852073-53852095 AGGAAGAAGGGGAAAAAGGACGG - Intergenic
1175452084 20:59077886-59077908 AAGGAGAAGGAGAAAAAGGAGGG + Intergenic
1175676760 20:60952921-60952943 ATCAGGAAGGAGAAGCAGGATGG + Intergenic
1176031125 20:63012574-63012596 TTTAAGAAGGAAAAACAGGATGG - Intergenic
1176963037 21:15181051-15181073 TTGAACAATGAGACACAGGGAGG - Intergenic
1177788477 21:25696438-25696460 ATGAACAACATGAAAAAGGAAGG - Intronic
1177919934 21:27139878-27139900 AACAAAAAGGAGAAACAGAATGG + Intergenic
1178479452 21:32967083-32967105 ATTACCAAGAAGAAACATGAGGG + Intergenic
1178496222 21:33088700-33088722 AAAAAGAAGGAGAAAAAGGAGGG + Intergenic
1178712870 21:34934913-34934935 ATGAAAAAGGGGAAAAATGAAGG - Intronic
1178723997 21:35035254-35035276 AGGAAAAGGGAGAAACAGAAAGG + Intronic
1179129807 21:38624686-38624708 AAGAACATTGAGATACAGGAAGG - Intronic
1179238311 21:39566557-39566579 AGGGACAAGAAGAAGCAGGAGGG - Intronic
1181771399 22:25128272-25128294 ATGAACATGAAGAAACATTAAGG - Intronic
1182024117 22:27104095-27104117 ATCAGGAAGGGGAAACAGGAGGG + Intergenic
1182469148 22:30536691-30536713 TTGAACAAGGAGGAGGAGGAGGG + Intronic
1182593224 22:31398306-31398328 ATAAAGAGGGAGAAACAGAAGGG - Intergenic
1182615480 22:31586169-31586191 AGGTACAAAGAGAAGCAGGAGGG - Intronic
1182662251 22:31933361-31933383 AGGAGCAAGGAGGCACAGGAAGG - Intergenic
1182706370 22:32283120-32283142 ATGCAGAAGGAGCAATAGGAGGG - Intergenic
1182707352 22:32293688-32293710 AGGAATAAAGAGCAACAGGAAGG - Intergenic
1182890198 22:33811808-33811830 ATGGATTAGGAGACACAGGAAGG + Intronic
1182907400 22:33950013-33950035 CTGAAGAAGGAGAAACAGAGGGG - Intergenic
1183257335 22:36770968-36770990 AAGAAAAAGGAGAAGCAGGCGGG - Intronic
1183628693 22:39020536-39020558 GGGAAGAAGGAGAAGCAGGAAGG + Intronic
1183632172 22:39040295-39040317 GGGAAGAAGGAGAAGCAGGAAGG + Intergenic
1183637993 22:39076696-39076718 GGGAAGAAGGAGAAGCAGGAAGG + Intronic
1184395693 22:44237077-44237099 AGGAATAAAGAGCAACAGGAAGG - Intergenic
1184928400 22:47660741-47660763 ATGAAGAAGGAGGAAGAGGAGGG - Intergenic
949354802 3:3168467-3168489 ATGAACTAGTGCAAACAGGAAGG + Intronic
949592375 3:5507943-5507965 ATGGAAAAGGAGACTCAGGAAGG + Intergenic
950261461 3:11545531-11545553 ATGGACAAGAAGAGACAGGGAGG - Intronic
951001330 3:17563438-17563460 ATGAATCAGGAAAATCAGGAAGG + Intronic
951277403 3:20705214-20705236 ATAGACAGGGAGAAAAAGGAAGG - Intergenic
951875207 3:27417246-27417268 ATGAACAGGGAGAACCAGGCAGG + Intronic
952169488 3:30791241-30791263 CTGAAAAGGGAGAAAAAGGATGG - Intronic
952485235 3:33803086-33803108 ATGAACATGGACAAAAAGAACGG - Intronic
952516944 3:34114011-34114033 ATGAAGAAGAAGAAAAAGAAAGG - Intergenic
952578053 3:34798532-34798554 ATAAACAATGAGAGAGAGGAAGG + Intergenic
952985870 3:38782458-38782480 AAGAACAAAGAGAAAGAGAATGG - Intronic
953148047 3:40297029-40297051 AAGAACAGGGAGAAAAAGGCAGG - Intergenic
953896642 3:46808304-46808326 AGCAGCAAGGAGAAGCAGGAAGG + Intronic
954093904 3:48307461-48307483 ATGAAAATGGAGAAAGAAGAGGG - Intronic
954367420 3:50154107-50154129 AGGAAAGAGGAGAAAGAGGAGGG + Intergenic
955921834 3:63965172-63965194 ACAACCAAGGAGAAACTGGATGG - Intronic
955959673 3:64327429-64327451 AGGAAAAAAGAGAAAAAGGAGGG + Intronic
956017488 3:64898817-64898839 AGGAACAAGATCAAACAGGAGGG + Intergenic
956202630 3:66722314-66722336 AAGAAGAAGGAGAAAGAGGGAGG - Intergenic
956429245 3:69167801-69167823 ATGAAAACAGAGAAACAGGCCGG + Intergenic
957179884 3:76862718-76862740 AGAAAAAAGCAGAAACAGGAAGG - Intronic
957573289 3:81976712-81976734 AAGAAGGAGGAGAAAGAGGAGGG + Intergenic
958134245 3:89466852-89466874 ATTAAAAAAGAGAGACAGGAGGG - Intronic
958689246 3:97441259-97441281 ATGAACAAGTGTTAACAGGAAGG + Intronic
959023673 3:101216023-101216045 ATGGTCAAGGAGAACCTGGAGGG - Intergenic
959188300 3:103075593-103075615 TTGAAAAAGGAGAAAATGGAGGG + Intergenic
959317798 3:104831080-104831102 ATGAACAAGATGAAGAAGGAAGG + Intergenic
959552567 3:107679687-107679709 ATGAACAAACAGAACCAGAAAGG + Intronic
959967162 3:112369230-112369252 ATAAAAAAGGAGACACAGGGAGG - Intergenic
960203274 3:114864183-114864205 ATGAACATGTACAAACAGAAAGG - Intronic
960682644 3:120265073-120265095 ATGACTTAGGAGAAGCAGGAGGG + Intronic
960799665 3:121525447-121525469 CTGATGAAGGAGAAACAGAAGGG + Intronic
961186057 3:124916028-124916050 AAGAAAAAGGAGAAACAACAGGG - Intronic
961879406 3:130050281-130050303 AAGAAGAAGGAGAAGAAGGAAGG + Intergenic
962005856 3:131349006-131349028 TAGAACAAAGGGAAACAGGATGG - Intronic
962898134 3:139734270-139734292 ATCAACACGCATAAACAGGAAGG + Intergenic
963303088 3:143620613-143620635 TTGAAAAAGGAGAAACAGGGGGG + Intronic
963762273 3:149295784-149295806 ATGCACAAGGAGCAGCAGGAAGG - Intergenic
963873096 3:150441386-150441408 AGGTAGAAGGAAAAACAGGAGGG - Intronic
964302194 3:155300970-155300992 ATAAACAGGGATAAAGAGGAAGG + Intergenic
964337362 3:155669810-155669832 TTCAACAAGTAGAAATAGGAAGG + Intronic
964501636 3:157354526-157354548 ATGAATAAGGAGAAGCAGCAAGG - Intronic
965006355 3:163031223-163031245 ACCAACAAGCAGAAAAAGGAGGG - Intergenic
965764430 3:172115158-172115180 AAGAATGAGGAGACACAGGATGG - Intronic
965906494 3:173713980-173714002 AAGAAAAAGGAGAAAGATGAAGG + Intronic
966218066 3:177522699-177522721 TTGAACAAGGACAAACATGCAGG + Intergenic
967617561 3:191590377-191590399 TGGAAGAAGGAGAAACAGCATGG + Intergenic
967630984 3:191742784-191742806 AAGATAAAGGAGCAACAGGAGGG - Intergenic
967899830 3:194438183-194438205 AAGAACAAATATAAACAGGAAGG + Intronic
967949752 3:194831738-194831760 ATGAAACAGGAGACATAGGAGGG + Intergenic
969727189 4:8927306-8927328 TAGTAAAAGGAGAAACAGGAGGG - Intergenic
970010264 4:11450839-11450861 ATGAACAAGGAGAACTGAGAAGG - Intergenic
970074097 4:12197598-12197620 ATGAGGAAGGAGGCACAGGAAGG + Intergenic
970218840 4:13786497-13786519 ATGAAGAAGGAAAAAAGGGAGGG - Intergenic
970789908 4:19845115-19845137 ATGAACAAGGGGAAAAGGTATGG - Intergenic
971132030 4:23822179-23822201 ATCAATAAGGAGCAACAAGATGG - Intronic
971218788 4:24686282-24686304 AAGAAAAAGTAGTAACAGGAGGG + Intergenic
971272859 4:25167105-25167127 AGGAACTGGGAAAAACAGGAGGG - Intronic
971278366 4:25219555-25219577 GAGAAGGAGGAGAAACAGGAGGG + Intronic
971305114 4:25473289-25473311 ATGAAGAAGGAGAAGGAGAAGGG + Intergenic
971947041 4:33292854-33292876 CTGAACAAGGAAAAAAAAGAGGG - Intergenic
973208904 4:47592629-47592651 ATGAGCATGGAGATTCAGGAAGG - Exonic
973238834 4:47934976-47934998 AAGAACAAGAAGAAAAAGAAAGG + Intronic
973816054 4:54620086-54620108 ATGAATAAGGAAAGACAGAAAGG - Intergenic
974136922 4:57830071-57830093 AGGAAGAAAGAGAAAGAGGAAGG + Intergenic
974325325 4:60407177-60407199 ATTAACAAGAAGAAACATCAAGG + Intergenic
974546047 4:63308206-63308228 AGGAAACAGAAGAAACAGGAAGG + Intergenic
975031983 4:69632509-69632531 ATGACCAACTAAAAACAGGAGGG + Intronic
975390656 4:73813400-73813422 ATGAGGATGGAGAGACAGGATGG + Intergenic
975825128 4:78311486-78311508 ATGCAGATGGAGAAAAAGGAGGG - Intronic
976672461 4:87668769-87668791 ATGGAAAAAGAGAAAGAGGAAGG + Intergenic
977209180 4:94198574-94198596 ATGCATAAGCAGAAAAAGGAAGG + Intergenic
977790927 4:101102214-101102236 ATGAAGAAGGAAAGAAAGGAGGG + Intronic
978247288 4:106589247-106589269 ATGAACAGACAGAAAGAGGATGG - Intergenic
978480137 4:109179389-109179411 ATGACCATGGTGTAACAGGATGG - Intronic
978627015 4:110697850-110697872 ATGAACATGGGGATACAGGCAGG + Intergenic
979405014 4:120299168-120299190 AAGAAAAAGGAGAAAGAGGAAGG - Intergenic
979670719 4:123357546-123357568 AGGAAGAAGGAAAAGCAGGAGGG - Intergenic
980518944 4:133905507-133905529 ATAAACAAGGATAAATAGAAGGG - Intergenic
981041637 4:140228244-140228266 ATGAAGAAGGAGGAGGAGGAGGG - Intergenic
981075771 4:140589851-140589873 AAGAAGAAGGAGAAACAAAACGG - Intergenic
981468702 4:145103676-145103698 CTGAAAAAGGGGAAGCAGGATGG - Intronic
981856147 4:149295306-149295328 AAGAAGAAAGAGAAACACGAGGG + Intergenic
982079731 4:151777687-151777709 ATGAAGAAAGAGATACAGGGAGG - Intergenic
982106574 4:152016568-152016590 ATGAGAGAGGAGAGACAGGAGGG + Intergenic
983273655 4:165592059-165592081 ATGAACAAAGAGAAAGAGGGAGG - Intergenic
983319497 4:166177900-166177922 ATGAGCAAGGAGAGACTGAAAGG + Intergenic
983640759 4:169942127-169942149 TTGAAAAAGCAGAAGCAGGAAGG + Intergenic
984085034 4:175299698-175299720 ATAAAGTAGAAGAAACAGGAAGG + Intergenic
984318284 4:178157458-178157480 AGGAACAAGGTGAAAGATGAGGG + Intergenic
984632567 4:182076187-182076209 AAGAAGAAGGAGAAAGAGGCTGG - Intergenic
984632615 4:182076496-182076518 ATAAAGAAGGAGAAAGAGGCTGG - Intergenic
984888479 4:184472640-184472662 AAGGACAAGGAGCAACCGGAGGG + Intronic
985707850 5:1411650-1411672 AGAAACAAGGAGGAGCAGGAGGG + Intronic
986228203 5:5836764-5836786 ATGACACAGGAGAATCAGGAGGG - Intergenic
986377667 5:7148793-7148815 ATGAAAAAAGAGAAGCAGCAAGG + Intergenic
986470375 5:8067830-8067852 ATGAAGTAGGAGAGAAAGGAGGG + Intergenic
986901179 5:12435738-12435760 ATGAAAAAAGAGGAAAAGGAAGG - Intergenic
987263807 5:16230146-16230168 GTGAAAAAGGAGATAAAGGAAGG + Intergenic
987360591 5:17103014-17103036 ATAAAAAAGGAGAAAGAGGCCGG - Intronic
987841937 5:23233392-23233414 TTAAGCATGGAGAAACAGGATGG - Intergenic
987852040 5:23367966-23367988 ATTACCCAGGAGAAACAGCAGGG - Intergenic
987919496 5:24260468-24260490 ATGAACAAGGGGAAAAAAGTGGG - Intergenic
988092231 5:26558642-26558664 ATGAAAAAAGAAAAAAAGGAAGG + Intergenic
989127940 5:38075045-38075067 ATGTGCAAGGAAAAGCAGGAAGG + Intergenic
989518710 5:42375443-42375465 ATGAACTAGGAGAAATACGGAGG - Intergenic
989637429 5:43551121-43551143 AGGAAGTAGGAAAAACAGGATGG + Intronic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
991000840 5:61781282-61781304 ATGAAGAGGGAGCAAGAGGATGG + Intergenic
991115038 5:62945512-62945534 GTGAATACGGAGAAACATGATGG - Intergenic
992097393 5:73375665-73375687 AAGAACAAGCAGGAAGAGGAAGG + Intergenic
992133615 5:73720344-73720366 TTGAAAAAGAAGAAAAAGGAAGG + Intronic
992719255 5:79543667-79543689 ATAAAGAATGAGAAACAGGCTGG - Intergenic
993033711 5:82733739-82733761 ATGAAGGATGAGAGACAGGAGGG + Intergenic
993193926 5:84715871-84715893 ATGAACAAGATGAGGCAGGAAGG - Intergenic
993313329 5:86366363-86366385 ATGAAAAAGGAGAAAAAATATGG - Intergenic
993389295 5:87298425-87298447 AAAAAGAAGAAGAAACAGGAAGG + Intronic
995192757 5:109336448-109336470 TTAACCAAGGAGAAACAGGTTGG + Exonic
996482345 5:123988955-123988977 AAGAGCAAGGAAAAACAGGGTGG - Intergenic
996501395 5:124220560-124220582 AAGAAAAAGAAGAAAGAGGAGGG - Intergenic
996522067 5:124438300-124438322 ATAAACAAGAAAAAGCAGGAAGG + Intergenic
996813746 5:127550309-127550331 ATGAATAAAAAGAAACAGGGAGG - Intronic
997026570 5:130069802-130069824 AAGAAGAAGGAGAAACATAAAGG - Intronic
998250655 5:140549906-140549928 AGGCACAGGGAGAGACAGGATGG - Intronic
998338843 5:141398668-141398690 ATAATTAAGGAGAAACAGGATGG + Exonic
998981526 5:147708471-147708493 ACGTAGAAGGAGAAACAGGTTGG + Intronic
999525164 5:152397045-152397067 ATGACCAAGGAGAAAAGGGGAGG + Intronic
999831190 5:155321910-155321932 ATGAACAAGGAGATGGGGGAGGG - Intergenic
1001026551 5:168229307-168229329 ATGACCACGGATAAGCAGGAAGG - Intronic
1001897571 5:175394525-175394547 ATGAACAAAGAGGATAAGGAAGG - Intergenic
1002692603 5:181060596-181060618 TTTAAAAAGGAGAAACAGGAAGG + Exonic
1002795100 6:465644-465666 AGGAGAAAGGAGAAAGAGGATGG - Intergenic
1002809681 6:615539-615561 ATGAAAAACCAGAAACAGGCTGG + Intronic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1004420614 6:15466235-15466257 AGGAAACAGGAGAAGCAGGAGGG - Intronic
1004462717 6:15853434-15853456 AAGAAGAAGGAGAAGCAGAAGGG - Intergenic
1004589719 6:17037837-17037859 ACGAAAAAGGAGAATCTGGATGG - Intergenic
1004703159 6:18098135-18098157 AGAAACTTGGAGAAACAGGAGGG + Intergenic
1004758435 6:18639122-18639144 AAGGACAAGGTGAAACAGGGTGG + Intergenic
1004759921 6:18655334-18655356 TTAAGCAATGAGAAACAGGAGGG - Intergenic
1005168988 6:22959474-22959496 ATGCACAGCGAGAAACAGAATGG + Intergenic
1005283828 6:24303075-24303097 ATGAACAAGCAGAGACAGCCGGG - Intronic
1005648294 6:27863459-27863481 ATTAAAATGGAGAAAGAGGAAGG - Intronic
1005657643 6:27958117-27958139 AGGAACAAGGAGGTAAAGGAAGG + Exonic
1005881860 6:30068291-30068313 AGGAAGACGGAGAAACAGCAAGG + Intronic
1006258639 6:32850821-32850843 ATGAAGATGGAGAATCAGTAAGG + Intronic
1007184873 6:39961221-39961243 ATGGGAAATGAGAAACAGGAAGG - Intergenic
1007239323 6:40413812-40413834 AGGAACAAGAGGAAACAGGTGGG - Intronic
1007515707 6:42409691-42409713 AGGAACAAAGAGAAACTAGAGGG - Intronic
1007761480 6:44135941-44135963 ATGGACCAGGAGAACCTGGAAGG - Intronic
1008087806 6:47262741-47262763 ATGGACAAGGAGGAGCAGGAAGG + Intronic
1008439490 6:51516302-51516324 AAAAACAAGGAGAACCAGGAAGG - Intergenic
1008659036 6:53646597-53646619 AAGAACAAGGAGACCCAGGGAGG + Intergenic
1008800492 6:55362978-55363000 AGGAAGAAGAGGAAACAGGAAGG + Intronic
1009317333 6:62237513-62237535 ATCAAAAAGCAGAAACATGATGG + Intronic
1009516783 6:64629849-64629871 TTGAACAGGAAGAAACAGAACGG - Intronic
1010160770 6:72852024-72852046 AAGAAAAATGAGAAACAGAAAGG - Intronic
1010187132 6:73157339-73157361 AGGAGGAAGGGGAAACAGGAAGG + Intronic
1010582460 6:77616516-77616538 ATAAAAAAAGAGAAACAGAAAGG - Intergenic
1011216984 6:85015481-85015503 AAGAAAAAGGAGAGACAGAATGG + Intergenic
1011441689 6:87393802-87393824 ATCGATAAGGAGTAACAGGATGG - Intronic
1011501904 6:87999858-87999880 ATGAAAAAGCAGCAAGAGGATGG + Intergenic
1011620960 6:89242141-89242163 ATCAACAATGAGAAATAGGCCGG - Intergenic
1011716008 6:90105755-90105777 ATGAACAAGAAGAAAAGTGAAGG + Intronic
1012693276 6:102344929-102344951 ATGAACACTGAGATCCAGGAGGG - Intergenic
1013275678 6:108582743-108582765 CTGACCCAGGAAAAACAGGACGG + Intronic
1013521509 6:110937954-110937976 ATGAACAAGAAGAGACTGGAAGG + Intergenic
1013603932 6:111730888-111730910 ACCAGCAAAGAGAAACAGGAAGG + Intronic
1014356053 6:120411634-120411656 ATGAAAAAGAAAGAACAGGAAGG + Intergenic
1015156533 6:130102593-130102615 ATGAACCGGGAGAAGCAGGCAGG - Intronic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015275285 6:131377741-131377763 TTGAAGAAGGAGAAAGGGGAGGG - Intergenic
1015515351 6:134077929-134077951 ATGAAGAAGGATAACCAAGAAGG + Intergenic
1015725840 6:136298493-136298515 ATAAACAAGAAGAATAAGGATGG + Intergenic
1016356594 6:143225135-143225157 TTGAACAGGCAGAGACAGGAGGG - Intronic
1016422840 6:143902638-143902660 ATGAACAAAGAAAAACAGATTGG - Intronic
1016457861 6:144249838-144249860 TTGAGCAAGGAAAAAAAGGAAGG - Intergenic
1016686930 6:146892251-146892273 ATGAACCAGGAGAGTCAGAAAGG + Intergenic
1016701320 6:147057396-147057418 ATAAAAAAGGAGGAACAAGAAGG - Intergenic
1016784185 6:147991985-147992007 TTGAACAAGGAGCTACAAGAAGG - Intergenic
1016804972 6:148203393-148203415 GTGATAAAGGAGAAACAGAAAGG - Intergenic
1017531577 6:155297652-155297674 ATGTAAAAGGAAAAACAGGAGGG + Intronic
1018153860 6:160966612-160966634 GATCACAAGGAGAAACAGGAAGG - Intergenic
1019576832 7:1741610-1741632 ATGAACCAGGTGAGCCAGGAAGG + Intronic
1019772802 7:2894376-2894398 ATGAAGAAGGAGACACAGAGAGG - Intergenic
1021583067 7:22177484-22177506 ATGGGCAAGGAGAAAAAGTAAGG + Intronic
1022566893 7:31412877-31412899 ATGAAGAAGGAGGGAAAGGAAGG + Intergenic
1022770833 7:33471159-33471181 ATGAAACAGGAGAAACAGCTTGG - Intronic
1023047089 7:36219590-36219612 AAGAAGAAGGAGGAAGAGGAAGG + Intronic
1023047096 7:36219639-36219661 AAGAAGAAGGAGGAAGAGGAAGG + Intronic
1023132807 7:37019592-37019614 ATAAACAAAGAAAACCAGGAAGG + Intronic
1023199152 7:37674980-37675002 ATGAACAACTAGAGACTGGATGG + Intergenic
1023214496 7:37847531-37847553 AAGAAGAAGGAGAAAGAAGAAGG + Intronic
1023440202 7:40177568-40177590 ATTAACAAAGAGAAATAAGAAGG - Intronic
1023584391 7:41714244-41714266 AGGAAGAAAGAGAAAGAGGAGGG + Intergenic
1023662889 7:42488755-42488777 AGGAACCAGGAGGTACAGGAAGG - Intergenic
1024032259 7:45471425-45471447 AAGAAGGAGGAGAAACAAGAAGG + Intergenic
1024475198 7:49801907-49801929 GTGAAGGAGGAGAAACAGGGTGG - Intronic
1024878228 7:54052733-54052755 ATGAACAAGGATATAGAGTAGGG - Intergenic
1025887791 7:65614601-65614623 AGGAAGAAGGAGGAAGAGGAAGG - Intergenic
1026104155 7:67407864-67407886 ATGAGGAAGGGGAGACAGGAGGG - Intergenic
1026158951 7:67852217-67852239 AAGAGAAAGGAGAAAGAGGAGGG + Intergenic
1026159082 7:67852903-67852925 AAGAACAAGGAGATAGAGGGGGG + Intergenic
1026207786 7:68273249-68273271 ATAAACTTGAAGAAACAGGAAGG - Intergenic
1026449776 7:70518106-70518128 ATGAACATTCAGAAACAGAATGG + Intronic
1026680876 7:72465780-72465802 ATGATCAAAGAGAAACAGAAAGG + Intergenic
1027201273 7:76065270-76065292 ATGAACAAGGAGCGACAGGGAGG - Intronic
1027351164 7:77313031-77313053 AGGAAGAATGAGAAACATGAGGG - Intronic
1027426405 7:78065632-78065654 ATGCACATGGAGAGACTGGAAGG + Intronic
1027882216 7:83855132-83855154 AAGAAGAAGGAGAAAGAGGCAGG + Intergenic
1028042187 7:86066937-86066959 AAGAACAAAAACAAACAGGAGGG - Intergenic
1028248097 7:88507087-88507109 AAGAAAAAGGAGAAACACAATGG - Intergenic
1028472463 7:91220089-91220111 ATGAAAATGGAGAGAAAGGAAGG - Intergenic
1028970602 7:96854410-96854432 ATGAAGAAAGTGAAACAGGGAGG + Intergenic
1029009740 7:97246453-97246475 ATGAACAAAAAGAAAAAGGCCGG + Intergenic
1029956686 7:104647772-104647794 AGGAAGAAGGAGAAAGAGGAAGG + Intronic
1029966397 7:104745245-104745267 AGGAAGAAGGAGAAAGAGGAAGG - Intronic
1030016777 7:105230516-105230538 ATGAAGAAAGAAAGACAGGAAGG + Intronic
1030108750 7:106008821-106008843 AGGAACAAGGAAGAGCAGGAGGG - Intronic
1030691607 7:112540874-112540896 ATGAACATATAGACACAGGAAGG - Intergenic
1030737574 7:113067832-113067854 CTGAACAAAGAGAGACAGGGAGG + Intergenic
1030954743 7:115838092-115838114 TTGAATAATGAGACACAGGAAGG - Intergenic
1031419530 7:121533676-121533698 CTGAACAAAGAGAGACAGGGAGG - Intergenic
1031498781 7:122485609-122485631 AAGTACAAGGTGAAACAGCAAGG + Intronic
1032463456 7:132128520-132128542 ATGAGCAAGGGGAAAGAGAAGGG + Exonic
1032682461 7:134199277-134199299 ATGAACAAGGAAAAATATGAGGG + Exonic
1032830311 7:135618149-135618171 AGGTACAAGGAGAAAGAAGATGG + Intronic
1033718553 7:144030721-144030743 ATGAGAGAGGAGAGACAGGAAGG - Intergenic
1033854390 7:145540714-145540736 AAGAAGAAGGAAAAAAAGGAAGG - Intergenic
1034978901 7:155463399-155463421 AGGAAAAAGGAGAAGGAGGAGGG - Exonic
1035006941 7:155670791-155670813 ATGACTAATGAGAAACAGGATGG - Intronic
1035097190 7:156365312-156365334 CTGAACCAGAAGAAACTGGATGG + Intergenic
1035232727 7:157476125-157476147 CTGGAGAATGAGAAACAGGATGG + Intergenic
1035440030 7:158889382-158889404 ATGAACTAGGAAAAACAGGAGGG - Intronic
1035521151 8:275764-275786 AAAAGCAAGGAGACACAGGAGGG + Intergenic
1035551718 8:533103-533125 AAGAACAAGGGGAGACAGCATGG - Intronic
1036039647 8:5060994-5061016 CTGAGCAAGGAGGAAGAGGAAGG - Intergenic
1037312184 8:17567978-17568000 ATTCACAAGCAGAAACAGAAAGG - Exonic
1037608072 8:20454152-20454174 GTGAACAAGGAGACAGAGGGTGG - Intergenic
1037745356 8:21639425-21639447 AGGAAGAGGGAGAAACAGGGAGG + Intergenic
1038138243 8:24814068-24814090 AAGTAGAAGGAGAGACAGGAAGG - Intergenic
1039513157 8:38107566-38107588 ATGAGAAAGGAAAAAAAGGATGG - Intronic
1040104467 8:43533804-43533826 AAGAAAAAGGGAAAACAGGAGGG - Intergenic
1040740392 8:50567952-50567974 ATGAATACAGAGATACAGGAAGG - Intronic
1041321249 8:56615151-56615173 AGGAAAAAAGAGAAAGAGGAAGG - Intergenic
1042120399 8:65481259-65481281 AGGAAGAAGAAGAAACAGGTGGG - Intergenic
1042190757 8:66184572-66184594 ATGAAAAATGAGAATCAGGCTGG - Intergenic
1042311061 8:67379859-67379881 AAGAACAAGGAGAAGGAAGAAGG - Intergenic
1042537255 8:69871170-69871192 AAGAGCAAGAAGAAAAAGGAAGG + Intergenic
1043043685 8:75294228-75294250 ATCAAGATGGAAAAACAGGAAGG + Intergenic
1043276549 8:78403403-78403425 AAGAAAAAGGAAAAACAGAAGGG + Intergenic
1043503952 8:80884610-80884632 AGGAAGAAGAAGAAAGAGGAAGG + Intergenic
1043520503 8:81040132-81040154 ATGTACATAGAGAAACAGGGTGG - Intronic
1044162312 8:88935148-88935170 ATGAACATTGAGATTCAGGAGGG - Intergenic
1044460987 8:92443684-92443706 ATGAAGAAGGAGGAGCAGGTTGG + Intergenic
1044485451 8:92747793-92747815 TGGAACAAAGATAAACAGGATGG + Intergenic
1044569683 8:93702526-93702548 ATGAACAATGACAAAAAGGTAGG + Intronic
1045058322 8:98389191-98389213 ATGGAGAAGGTGAAACAGGCTGG - Intergenic
1045359532 8:101419886-101419908 ATAAAGAAGGAAAAAAAGGAAGG + Intergenic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046025766 8:108721793-108721815 AGGGGCAAGGAGAAACAGAAAGG - Intronic
1046093941 8:109536037-109536059 ATTAACAAAGGGAAACAGGGAGG - Intergenic
1046184474 8:110694624-110694646 AGGAAGAAGGACAAAGAGGAAGG + Intergenic
1046560521 8:115831692-115831714 ATGAACTAGGAGACTCAGTAAGG - Intergenic
1046618810 8:116506059-116506081 ATTATCAAGAAGCAACAGGATGG + Intergenic
1047457093 8:125025017-125025039 ACCAACAAGGAAGAACAGGATGG + Intronic
1047568487 8:126072785-126072807 AAGAAAAAGGAGAAAAAGAAGGG + Intergenic
1047921508 8:129639408-129639430 ATGAAGAGGGAGAATCAGGGAGG + Intergenic
1048001794 8:130385046-130385068 TTGAACAAGGAGCTACAAGAGGG + Intronic
1048403759 8:134097269-134097291 AAGAAAAAGGAGAAATAGGGAGG + Intergenic
1050005397 9:1124410-1124432 AAGAACACTGAGACACAGGAGGG + Intergenic
1050306192 9:4308243-4308265 ATGAACTGGAAGGAACAGGAAGG + Intronic
1051182015 9:14421166-14421188 ATGAAGGAAGAAAAACAGGAAGG - Intergenic
1052754991 9:32531840-32531862 ATCAAAAAGCAGAAACTGGAGGG - Intergenic
1053274930 9:36776108-36776130 AAGATCAAGGAGAGACTGGAAGG - Intergenic
1054924142 9:70571948-70571970 ATGGACATGGAGAAAAAGAAGGG - Intronic
1055212762 9:73817170-73817192 AGGAAAAAGGAGAAAAAGGCGGG + Intergenic
1055247381 9:74263571-74263593 ATTAACAGGAAGAAAAAGGATGG - Intergenic
1055362057 9:75502502-75502524 AGAAACAAGGAGAAAAAAGATGG - Intergenic
1055410433 9:76023283-76023305 ATGAACAAGGGAAGACAGGAAGG - Intronic
1055913941 9:81380920-81380942 AGGAACAAGGAGAAAAATCAAGG + Intergenic
1056139168 9:83657770-83657792 ATGAACAAGGGGGAAAAGCAGGG - Intergenic
1057089177 9:92240895-92240917 ATGCACAAGCAGGACCAGGAAGG + Exonic
1057339816 9:94190062-94190084 ATGGAAAATGAGAAGCAGGAGGG - Intergenic
1057544296 9:96005821-96005843 ATGAACAAGGGGTAACAAGAAGG + Intronic
1058245682 9:102622086-102622108 ATTAAAAAGGAAAACCAGGATGG - Intergenic
1058654367 9:107206457-107206479 TTGAAAAAGGTGGAACAGGATGG + Intergenic
1059492619 9:114681792-114681814 ATGAATGAGGTCAAACAGGAAGG + Intergenic
1060109152 9:120894297-120894319 AGCAGAAAGGAGAAACAGGATGG + Intronic
1060517027 9:124272266-124272288 ATGAACAAAGAAAACAAGGAAGG - Intronic
1061541617 9:131280532-131280554 CTGAAAAATGAGAAAGAGGAGGG + Intergenic
1185603480 X:1354577-1354599 AAGAAAACGGAGAAAGAGGAGGG + Intronic
1185727639 X:2435157-2435179 ATGCAGAGAGAGAAACAGGAGGG + Intronic
1186039917 X:5464393-5464415 ATGAGAAAGGAAGAACAGGAAGG + Intergenic
1186072904 X:5842106-5842128 AAGCAGAAGCAGAAACAGGAGGG + Intronic
1186236179 X:7513421-7513443 ATGGACAAGAGGAAACATGACGG + Intergenic
1186530291 X:10288360-10288382 AGGAGCAAGAAGAAAAAGGATGG - Intergenic
1187286482 X:17909395-17909417 ATGAATAAGAAGAATCAGTATGG - Intergenic
1187652535 X:21424749-21424771 AGGAACAAGGGGAAAAATGAAGG - Intronic
1188036461 X:25322941-25322963 GAGAAAAAGGAGAAAGAGGAAGG - Intergenic
1189087490 X:38041143-38041165 AGAAGGAAGGAGAAACAGGAGGG + Intronic
1189170169 X:38901345-38901367 TTGAAAAGGGACAAACAGGAAGG - Intergenic
1189206391 X:39242911-39242933 ATGAGCAAGCAGAAATTGGAAGG - Intergenic
1190327071 X:49213055-49213077 ATGAACAAGGTGAGATATGATGG + Intronic
1190409697 X:50124209-50124231 ATGAAGAAAGATAAACAGAATGG + Intergenic
1191887728 X:65906213-65906235 ATGAAGAAAGAAATACAGGAGGG + Intergenic
1192681850 X:73260955-73260977 CTGAAGAAGTAGAATCAGGAAGG - Intergenic
1193817431 X:86121188-86121210 TTGAACAAGCAGAAAAAAGAAGG - Intergenic
1193940556 X:87676753-87676775 AGGAAAAAGGAGAAAAAGGGGGG + Intergenic
1194607959 X:96005470-96005492 AAGAACAAAGAAAAACAGGGTGG + Intergenic
1194764469 X:97833459-97833481 TTGTACAAAAAGAAACAGGAAGG - Intergenic
1195410524 X:104564854-104564876 ATAAACAACGAAAACCAGGAGGG + Intergenic
1195468500 X:105208089-105208111 ATGCACAGGGAAAAACAGGGAGG + Intronic
1196011647 X:110894427-110894449 CTGAAGAAGAAGAAAAAGGAAGG + Intergenic
1196102201 X:111858407-111858429 AGGAAAGAGGAGAAACAAGAAGG + Intronic
1196345624 X:114653645-114653667 ATGAACAAGGAGAAACAGGAGGG - Intronic
1197967732 X:132082876-132082898 ATGACCAACAGGAAACAGGAGGG + Intronic
1198233146 X:134712711-134712733 ATGAACCGGGAGAGGCAGGATGG - Intronic
1198390072 X:136165163-136165185 ATAAACAAGCAAAAACTGGAAGG - Intronic
1198837451 X:140819749-140819771 ATGAGCATGGAAAATCAGGAAGG + Intergenic
1199295103 X:146148403-146148425 ATTAACCATGAGAAACAGTAAGG + Intergenic
1199316528 X:146385254-146385276 ATGAAGATGGAGAGAGAGGAAGG + Intergenic
1200681697 Y:6220640-6220662 ATTAACAAAGAAAAAAAGGAGGG - Intergenic
1200686456 Y:6263948-6263970 CAGATCAAGGAGAAAGAGGATGG + Intergenic
1200691282 Y:6307670-6307692 ATCAAGAAGAAGAAAGAGGATGG - Intergenic
1200989330 Y:9334865-9334887 CGGATCAAGGAGAAAGAGGATGG + Intergenic
1200991999 Y:9355195-9355217 CGGATCAAGGAGAAAGAGGATGG + Intergenic
1200994653 Y:9375475-9375497 CGGATCAAGGAGAAAGAGGATGG + Intronic
1200997316 Y:9395821-9395843 CGGATCAAGGAGAAAGAGGATGG + Intergenic
1200999831 Y:9464358-9464380 CGGATCAAGGAGAAAGAGGATGG + Intergenic
1201002489 Y:9484667-9484689 CGGATCAAGGAGAAAGAGGATGG + Intronic
1201005149 Y:9504954-9504976 CGGATCAAGGAGAAAGAGGATGG + Intergenic
1201007807 Y:9525281-9525303 CGGATCAAGGAGAAAGAGGATGG + Intergenic
1201010424 Y:9545471-9545493 CTGATCAAGGAGAAAGAGGAGGG + Intergenic
1201043990 Y:9867046-9867068 ATCAAGAAGAAGAAAGAGGATGG + Intergenic
1202115245 Y:21465551-21465573 ACTAAGAAGGAGAAAGAGGATGG + Intergenic
1202161648 Y:21941027-21941049 GTCAAGAAGGAGAAACAGGATGG - Intergenic
1202229708 Y:22645346-22645368 GTCAAGAAGGAGAAACAGGATGG + Intergenic
1202313448 Y:23550819-23550841 GTCAAGAAGGAGAAACAGGATGG - Intergenic
1202557355 Y:26119776-26119798 GTCAAGAAGGAGAAACAGGATGG + Intergenic