ID: 1196352920

View in Genome Browser
Species Human (GRCh38)
Location X:114754251-114754273
Sequence TTCCTACCAAAACTCCAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 410
Summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 369}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196352920 Original CRISPR TTCCTACCAAAACTCCAAAA AGG Intronic
901583606 1:10267184-10267206 TCTCTACCAAAAATACAAAAAGG - Intronic
902313439 1:15599595-15599617 TTCATCCCGAAACTCCAAAAAGG - Intergenic
902550333 1:17215419-17215441 TTTCTACCAAGACTCCAAATAGG + Intronic
904766256 1:32850272-32850294 TTCCTACCAAAGCTTCACAAAGG - Intronic
907826416 1:58021484-58021506 TTCCAAATAAAACTCCAGAAAGG + Intronic
908957663 1:69653535-69653557 TTCCTACCAACAATGCAAAAAGG - Intronic
909309413 1:74127880-74127902 TGCCTACCAGAACTGCTAAAAGG - Intronic
909828990 1:80161565-80161587 GTTGTACCTAAACTCCAAAAGGG + Intergenic
909861726 1:80614436-80614458 TTCTTACCAAAAATTAAAAATGG + Intergenic
911011855 1:93288877-93288899 TTCCTAGAAAATCTCAAAAACGG + Intergenic
911028814 1:93464114-93464136 TTCCTACCAAAAGTGCACAAGGG - Intronic
911163338 1:94703374-94703396 TTCTTATCAAAACTCCAGCAAGG + Intergenic
911908875 1:103606114-103606136 TTCCCACCAAAACTCTATAAGGG - Intergenic
911921716 1:103771579-103771601 TTCCCACAAAAACTCTATAAGGG - Intergenic
912555855 1:110515552-110515574 TTCCTACCAGAACTGCACCATGG + Intergenic
915184231 1:154090874-154090896 TTCCTACCAACAGTGCACAAGGG - Intronic
915931960 1:160066342-160066364 TACCTTCCCAAACTCCAGAAGGG + Intronic
917198338 1:172490164-172490186 GTTGTACCTAAACTCCAAAAGGG + Intergenic
917505112 1:175620387-175620409 TTCCTACCAATACTCCAGCCTGG - Intronic
919120351 1:193332515-193332537 TTCCTATCAAAAATTCAAAAGGG - Intergenic
920888556 1:209958430-209958452 TTCCTATTAAAATTCCAAAAAGG - Intronic
921996411 1:221424730-221424752 TTCCTATCAATACCCCAACAGGG + Intergenic
922736702 1:227987747-227987769 TTCCTACAAAAAATGCTAAAGGG + Intergenic
923421503 1:233820469-233820491 TTCCTACCAACAGTGCACAAAGG + Intergenic
923918481 1:238536377-238536399 TTCTTATCAAAACACCATAAGGG - Intergenic
924507209 1:244697157-244697179 GTCCTAGCAAATCACCAAAACGG + Intronic
924659776 1:246005732-246005754 ATCCTATGAAAACTGCAAAAGGG + Intronic
1063106814 10:2999227-2999249 TGCCTGGGAAAACTCCAAAATGG + Intergenic
1063500667 10:6550819-6550841 TTCCCAGCAAAAGTGCAAAAAGG + Intronic
1063658098 10:8011589-8011611 TTCCTTCCAAAACTCCTTTAAGG - Intronic
1063785144 10:9374133-9374155 TTCTTTCCAGAGCTCCAAAAAGG - Intergenic
1064446742 10:15400549-15400571 TTCCTACCAGAAGTGCTAAAGGG + Intergenic
1065405739 10:25361544-25361566 TTCCTACCAACAATGCACAAGGG + Intronic
1065722491 10:28640421-28640443 TTCCAACCAATAGTCCACAAGGG + Intergenic
1065810954 10:29443330-29443352 GTTCTGCCTAAACTCCAAAATGG + Intergenic
1065938427 10:30542311-30542333 TTCCCACAAACACACCAAAAGGG - Intergenic
1066093262 10:32047409-32047431 CACCTAGCAAAACTCCAAATGGG + Intronic
1067415034 10:46096406-46096428 TTCCTTAAAAAACTCCAAAAAGG + Intergenic
1067424895 10:46200502-46200524 TGCCTCCCAAAGCTCCAAGAAGG + Intergenic
1068586308 10:58803182-58803204 TGCCCAGCAAAACTCCGAAAGGG + Exonic
1068704150 10:60054730-60054752 TTCCTCCCAAAACACTAAAGTGG + Intronic
1069316297 10:67107754-67107776 TCCCTGGCAAAACTCCAAACAGG + Intronic
1069669472 10:70189592-70189614 TCTCTACCAAAAATACAAAAAGG + Intergenic
1070861381 10:79666714-79666736 TGCCTCCCAAAGCTCCAAGAAGG + Intergenic
1072141914 10:92596474-92596496 TTCCTACCAACAGTGCATAAGGG + Intronic
1075316321 10:121456573-121456595 TTCAAACCAAAGCACCAAAACGG - Intergenic
1078003944 11:7518415-7518437 TTCCTTGCAGAACTCAAAAAGGG - Intronic
1078193103 11:9109727-9109749 TTGCTACCATGACTCCAAAGGGG + Intronic
1078481316 11:11678503-11678525 TTCCTCCTAAAACCCCAAAGAGG + Intergenic
1079712696 11:23707178-23707200 TTCCAACCAACAGTTCAAAAGGG + Intergenic
1079856827 11:25615261-25615283 TTCCTACCAACATTGCACAAGGG + Intergenic
1080096808 11:28418048-28418070 TTGATACCAGAACTCCAAACCGG - Intergenic
1080910956 11:36598061-36598083 TTTCTACCAAAGCTAAAAAATGG - Intronic
1082441148 11:52813786-52813808 TTCCAACGAAAACTTCAAAGAGG - Intergenic
1082547810 11:54355066-54355088 TTCCAACGAAAACTTCAAAGAGG - Intergenic
1082547971 11:54357114-54357136 TTCCAACGAAAACTTCAAAGAGG - Intergenic
1082549295 11:54374515-54374537 TTCCAACGAAAACTTCAAAGAGG - Intergenic
1082551424 11:54403183-54403205 TTCCAACGAAAACTTCAAAACGG - Intergenic
1082552499 11:54417512-54417534 TTCCAACGAAAACTTCAAAGAGG - Intergenic
1083079582 11:60076711-60076733 TTCCTACCAACAGTGCACAAGGG - Intergenic
1083481041 11:62947100-62947122 TCTCTACTAAAACTACAAAAGGG + Intronic
1085579336 11:77636960-77636982 TTCCTTCCAGGACCCCAAAACGG + Intronic
1086313363 11:85561443-85561465 TTCCTACCAGTATTACAAAAGGG + Intronic
1086846605 11:91757580-91757602 GAACTACCAAAACTCAAAAATGG - Intergenic
1086908019 11:92439746-92439768 TCTCTACAAAAACTTCAAAAAGG + Intronic
1087951765 11:104229057-104229079 TACCTACATAAACTCCTAAAGGG + Intergenic
1088233398 11:107697093-107697115 CTCCTACCAGACCTCCAATAAGG - Intergenic
1089495758 11:118908003-118908025 TTCCCACCAGAGCTCCAGAAGGG - Intronic
1089743475 11:120600893-120600915 TCCCTACAAAAAATACAAAAAGG + Intronic
1089839933 11:121407456-121407478 GTCTTGCCTAAACTCCAAAAGGG - Intergenic
1090103122 11:123822936-123822958 ATTGTACCTAAACTCCAAAAGGG + Intergenic
1090522150 11:127490735-127490757 TTCCTACCTAAACTACTCAAAGG + Intergenic
1091864880 12:3824120-3824142 TTCCCACAACCACTCCAAAAAGG + Intronic
1094218104 12:27966649-27966671 TACATACCTAAGCTCCAAAATGG + Intronic
1096685188 12:53283753-53283775 TGCCTTGCAAATCTCCAAAAGGG + Intronic
1097242008 12:57581924-57581946 TTCCTACCAGAAGGCCAACATGG + Exonic
1097523969 12:60706970-60706992 TCCCTACCAAAATTCCAATGTGG - Intergenic
1100510772 12:95270708-95270730 ATCCTAACAAAAATCCAATAAGG - Intronic
1100662491 12:96715237-96715259 TTCATACCAGAAATACAAAAAGG - Intronic
1100778697 12:98000834-98000856 TTTCTACTAAAAATACAAAAAGG - Intergenic
1100788783 12:98107931-98107953 TTGCTGCCAAAATTCCAATAAGG - Intergenic
1101414271 12:104495428-104495450 TTCCTACCAACAGTACACAAGGG + Intronic
1102312160 12:111854117-111854139 TTCATACCAAAACTCGAAAAAGG - Intronic
1102429577 12:112872151-112872173 TTCCCACCAACAATGCAAAAGGG + Intronic
1102757522 12:115354951-115354973 TTCCTACCCACACTCCAGAATGG - Intergenic
1105392954 13:19998786-19998808 TTACTACCAAAACTTTAAAAAGG - Intronic
1105755928 13:23464318-23464340 TTCCTACCAACAGTACACAAGGG - Intergenic
1106755442 13:32818554-32818576 TTCCTACCAAAAATGTATAAGGG - Intergenic
1107010539 13:35665926-35665948 CTTCTACAAAAACTCCAAAGAGG - Intronic
1107364159 13:39652003-39652025 TGTTTTCCAAAACTCCAAAAAGG - Intergenic
1107421119 13:40247735-40247757 TGCCTGACAAAACTCCAAAATGG - Intergenic
1107979215 13:45718257-45718279 GTTCTGCCTAAACTCCAAAAGGG - Intergenic
1108079847 13:46723829-46723851 TTCCTCACAAAACTCCACTAAGG - Intronic
1108208174 13:48112182-48112204 TTCCTAAGAAAAATGCAAAAAGG - Intergenic
1108957119 13:56173300-56173322 TTCCTACAAACAGTCCTAAACGG + Intergenic
1109278681 13:60330765-60330787 TTCCTCGCCAAACTCCAAAGGGG + Intergenic
1112248915 13:97760461-97760483 TTCCTACCAACAATATAAAAGGG + Intergenic
1112576164 13:100638680-100638702 TTACAACCAAACATCCAAAATGG - Intronic
1112792024 13:103013807-103013829 TTGCTACCAAACCAGCAAAAAGG + Intergenic
1113754417 13:112800426-112800448 TATCTACCAAAACTCAAACAAGG + Intronic
1114489661 14:23091428-23091450 TCTCTACCAAAAATACAAAAAGG + Intronic
1114965963 14:27959902-27959924 TTCATTCCAAAAATCCACAAAGG + Intergenic
1115292380 14:31786885-31786907 TTCCTAACAACACTGAAAAATGG - Intronic
1115934470 14:38536143-38536165 TTCCCACCAATAATGCAAAAGGG + Intergenic
1118533953 14:66737502-66737524 AAACAACCAAAACTCCAAAAAGG - Intronic
1119789377 14:77336100-77336122 TTCAAACCAAAACTTCAGAAGGG + Exonic
1121276734 14:92673111-92673133 TCTCTACCAAAAATACAAAAAGG + Intronic
1122763380 14:104047034-104047056 TCCCTACCACAATTCCAACAAGG - Intronic
1124432833 15:29621650-29621672 TTCCTACCAACAGTGCACAAGGG - Intergenic
1124837527 15:33209688-33209710 TACCTCCCAAAAGTCCCAAAAGG - Intergenic
1125305723 15:38310489-38310511 TTCCTATCAAAACCCCAGTAAGG - Intronic
1125619289 15:41045419-41045441 TCTCTACTAAAACTACAAAAGGG + Intronic
1126133046 15:45362479-45362501 TACCTACCAAATGTTCAAAATGG + Intronic
1128307627 15:66610400-66610422 TCCCATCCCAAACTCCAAAAAGG + Intronic
1128574558 15:68763329-68763351 TCTCTACAAAAAATCCAAAAAGG + Intergenic
1130925549 15:88383245-88383267 ATCCTCCCAAAACAACAAAAAGG + Intergenic
1131464975 15:92647559-92647581 TTTGTGCCTAAACTCCAAAAGGG - Intronic
1131539008 15:93260591-93260613 TTCCTCCAAACACACCAAAACGG - Intergenic
1132836442 16:1955714-1955736 TCTCTACCAAAAATACAAAAAGG - Intronic
1133581810 16:7151757-7151779 TTCCTACCATCACCCCAAGATGG - Intronic
1133675611 16:8068709-8068731 TTCCCACCAATAGTGCAAAAGGG + Intergenic
1133853158 16:9524951-9524973 TTCCTACAAATTCTCCCAAATGG + Intergenic
1135837068 16:25836084-25836106 TTCCTACCAAGCCTACAAAACGG + Intronic
1137534807 16:49312049-49312071 TTCCTACCAACAGTGCACAAGGG + Intergenic
1139101774 16:63776147-63776169 TCTCTACCAACACTCCAAACAGG - Intergenic
1139541803 16:67623471-67623493 TCTCTACCAAAAATACAAAACGG + Intronic
1140605759 16:76534926-76534948 TTCTTAACAAAATTGCAAAAGGG - Intronic
1140999734 16:80297164-80297186 CTTCCACCAAAACTCCAATAAGG + Intergenic
1141168153 16:81674298-81674320 TTTCTACTAAAAATACAAAAGGG - Intronic
1145071568 17:19813900-19813922 TTCCCATCAAAATCCCAAAATGG + Intronic
1145408179 17:22628887-22628909 TGCCTCCCAAAGCTCCAAGAAGG - Intergenic
1145439912 17:23091006-23091028 TTCCAACGAAAACTTCAAAGAGG - Intergenic
1145522459 17:24286375-24286397 TTCCTACGAAATCTTCAAAGAGG - Intergenic
1145549203 17:24675835-24675857 TTCCTACGAAATCTTCAAAGAGG - Intergenic
1145569563 17:24971483-24971505 TTCCAACCAAATCTTCAAAGAGG - Intergenic
1145601850 17:25441764-25441786 TTCCAACCAAATCTTCAAAGAGG - Intergenic
1145604161 17:25475532-25475554 TTCCAACCAAATCTTCAAAGAGG - Intergenic
1145612328 17:25594144-25594166 TTCCAACCAAATCTTCAAAGAGG - Intergenic
1148286636 17:46399126-46399148 TTCCCCCCAAAAGACCAAAATGG + Intergenic
1148308802 17:46616716-46616738 TTCCCCCCAAAAGACCAAAATGG + Intronic
1150183425 17:63152727-63152749 TTCCTTCTAAAACTCAAGAAAGG - Intronic
1151998113 17:77624611-77624633 TTTCTACCAAAATTCCAGCAAGG - Intergenic
1152138345 17:78520824-78520846 TTCCTATAAAAACCCCAATAAGG + Intronic
1153445296 18:5165338-5165360 TGCCTGTCAAAACTCCAAAGGGG + Intronic
1153643678 18:7176015-7176037 TCTCTACCAAAAGTACAAAAAGG - Intergenic
1154507625 18:15058431-15058453 TTCCTACCAACAATACACAAGGG + Intergenic
1155327192 18:24676485-24676507 TTCACCCCAAAACACCAAAAGGG - Intergenic
1155458866 18:26053670-26053692 TTCACACAAAAACTACAAAAAGG + Intronic
1155594384 18:27468015-27468037 TTCCTACCAAAAATATACAATGG + Intergenic
1155749986 18:29410258-29410280 TTCCTACCAAAATCCCAAGAAGG - Intergenic
1156166018 18:34421982-34422004 TTCTTACCAAAACTCCACGAGGG + Intergenic
1156197036 18:34786134-34786156 TTCCTACGACAACTCTCAAATGG - Intronic
1156636763 18:39040851-39040873 TCACTACTAAAACTGCAAAAAGG + Intergenic
1156993451 18:43438476-43438498 TAACTACCAAAAATACAAAATGG - Intergenic
1157883953 18:51348317-51348339 TTCCTACCAAAAAGACATAAGGG - Intergenic
1158045594 18:53151287-53151309 TTTCTACCCAAACTCTAGAATGG + Intronic
1158067824 18:53434559-53434581 TTCCTACAAATACACCATAAAGG - Intronic
1158460351 18:57641122-57641144 TTCCTACAATAACTTAAAAATGG - Intergenic
1158669321 18:59460762-59460784 TCTCTACCAAAAATACAAAAAGG + Intronic
1159567159 18:70064608-70064630 TTCATACAAAATGTCCAAAACGG + Intronic
1159599386 18:70414142-70414164 TTTCTACCCAAACTCCATCAGGG + Intergenic
1159961749 18:74560534-74560556 TCTCTACCAAAAATACAAAAAGG + Intronic
1160026695 18:75223840-75223862 TTAGTACCAACACTCCATAAAGG - Intronic
1164059883 19:21662015-21662037 TTCCTACTAAAAATACAAAATGG - Intergenic
1164264974 19:23606875-23606897 ATTCTACCAGAACTACAAAAAGG - Intronic
1165559527 19:36667116-36667138 TTCTCACCACAACTCCACAAAGG - Intergenic
925783741 2:7407964-7407986 TTTCTACTAAAACTCCAAACTGG - Intergenic
925861846 2:8185909-8185931 TTGATACCAAAACTAGAAAAAGG + Intergenic
926061592 2:9808144-9808166 TTACAACCAAAACCCCAAAAGGG - Intergenic
927067587 2:19489510-19489532 TTCCTATGAAATCTCCAAGAAGG + Intergenic
927405765 2:22764671-22764693 TTCCTACCAAAAATGTACAAGGG + Intergenic
927803669 2:26125211-26125233 TTCCTACCAACAGTACACAAAGG + Intronic
928718164 2:34087219-34087241 TTCCTCCCAAAATTCCAATGTGG - Intergenic
929634294 2:43501478-43501500 TTCTAACCAAAATTCCAAAAGGG + Intronic
930244311 2:48967650-48967672 TTTCTACAAATCCTCCAAAAGGG + Intronic
930291400 2:49498012-49498034 TTGGAACCAAAACTTCAAAATGG + Intergenic
931759166 2:65401284-65401306 TTCCTCCCAAAACTGTAAAATGG - Intronic
933722028 2:85403408-85403430 TTTCTACCAAAAATTTAAAAAGG + Intronic
933984491 2:87579374-87579396 TTCCCACCAAAAGTGCAGAAGGG - Intergenic
934707046 2:96489294-96489316 TTCTCACCACACCTCCAAAATGG - Intergenic
935114124 2:100119856-100119878 TTCCTTCAAAAACTTCACAATGG - Intronic
935305158 2:101730383-101730405 TCCCTACCACAACCCCAAAAAGG - Intronic
935448622 2:103184955-103184977 TTCCTACCAAAATCCCACCAAGG + Intergenic
935524092 2:104144299-104144321 ATCCTGCCAGAACTCCAAATGGG + Intergenic
936579938 2:113690549-113690571 TCCCTACCAAAACTCCAGTTAGG + Intergenic
936778023 2:115997392-115997414 GTCCTACCAAAAATGCTAAAGGG - Intergenic
937393394 2:121513329-121513351 CTCCTACAAATTCTCCAAAACGG - Intronic
938371386 2:130770705-130770727 GTTGTACCGAAACTCCAAAAGGG + Intergenic
939797172 2:146659936-146659958 GTTGTACCTAAACTCCAAAAGGG + Intergenic
941650454 2:168086889-168086911 GTCCTATCAAACCTCCAATATGG + Intronic
942255684 2:174095261-174095283 TTCCTACCAGTACTGCACAAGGG + Intronic
942385470 2:175438361-175438383 TTTCTACCAAAAAACCACAAAGG - Intergenic
943388193 2:187228015-187228037 TTCATAACAAAATTCTAAAAAGG + Intergenic
943666881 2:190618414-190618436 CTCCCACCAAAACTTAAAAAAGG + Intergenic
944053635 2:195499776-195499798 TTCCTAACAAAATCCCAACAAGG + Intergenic
944352994 2:198751898-198751920 TTACTCCCAAAGCACCAAAATGG - Intergenic
944354503 2:198770134-198770156 TTCCCACCAAAAGTTCAAAATGG - Intergenic
944693032 2:202175111-202175133 TTCCTACAAATACACTAAAAGGG - Intronic
945175000 2:207035275-207035297 TTCCTAGCAGAGCTCCAACATGG + Intergenic
947122031 2:226826449-226826471 TTGTTACCAAAACTACAAATAGG - Intergenic
947139225 2:227005904-227005926 TTCCTAGCAAAACAGAAAAAGGG + Exonic
947167438 2:227276750-227276772 CCCCCACCAAAACTCCAGAACGG - Intronic
947368464 2:229420801-229420823 TTCCTACCAACAGTGCACAAAGG - Intronic
1169967142 20:11230303-11230325 TTTCTAGCAAAACTGCACAACGG + Intergenic
1170641298 20:18155771-18155793 TTCCCACCAACACTGCAAAAGGG - Intronic
1171056077 20:21908373-21908395 TTCCTACCAAAGCTGGAGAATGG - Intergenic
1172194223 20:33081182-33081204 TTCCAACAAAAACACCAAACTGG - Intronic
1173106965 20:40146029-40146051 TTCCTACCAACAGTGCAAATGGG + Intergenic
1173304566 20:41835978-41836000 TTCCTACCTAAACTTTGAAAGGG + Intergenic
1176790454 21:13313350-13313372 TTCCTACCAACAATACACAAGGG - Intergenic
1177466598 21:21491344-21491366 TTGCTAGCAAAAGTCCATAAAGG + Intronic
1177779923 21:25611295-25611317 TTCTTACCAAAACCCCACACAGG + Intergenic
1177989628 21:28021592-28021614 TTCCTACCAACAATACACAAGGG - Intergenic
1179448916 21:41454405-41454427 TTTCAACCTAAACTCCAAAAGGG + Intronic
1179636984 21:42719002-42719024 TTCCTACTAAAACCACAGAAGGG - Intronic
1180061921 21:45390072-45390094 GTCCAACCAAAATCCCAAAAAGG - Intergenic
1180579595 22:16819238-16819260 TTCCTATCAAAATCTCAAAAAGG + Intronic
1181099468 22:20529757-20529779 TCCCTACTAAAAATACAAAAGGG - Intronic
1181862772 22:25832137-25832159 TTCCCACCAATACTGCACAAGGG - Intronic
1182476643 22:30580164-30580186 TCCCCACCAAAACTCCTACAGGG + Exonic
1182863825 22:33584781-33584803 ATCCAACCCAAACTCCAAACTGG + Intronic
1182863982 22:33586034-33586056 ATCCAACCCAAACTCCAAACTGG - Intronic
1183603733 22:38855897-38855919 TTCCTACCAACAGTGCACAAGGG + Intergenic
1184567892 22:45303785-45303807 TTTCTACAAAAACTAAAAAAAGG - Intergenic
950045842 3:9948091-9948113 TTCCAAACAAATCTGCAAAATGG + Intronic
950812252 3:15660094-15660116 TTCCTACCACAACCCCATGAGGG + Intergenic
951147853 3:19251040-19251062 TTCCAGCCAAAATTACAAAATGG + Intronic
951714939 3:25631908-25631930 TCCCCACCAAAATTCCAAAGAGG + Intronic
952844731 3:37678281-37678303 TTCCTACCAACAGTGCACAAGGG + Intronic
953500182 3:43425595-43425617 TTTGTACCTAAACTCCAAAAGGG - Intronic
953563679 3:44013623-44013645 TTCCTCCCAAAGCTGCCAAAGGG - Intergenic
956331276 3:68112182-68112204 CTCCCAACAAAACTCAAAAAAGG + Intronic
956719996 3:72109220-72109242 TCCCTCTCAAAACTACAAAAGGG - Intergenic
956981291 3:74641580-74641602 TTCCCACCAATAGTGCAAAAGGG - Intergenic
957027894 3:75205415-75205437 TTCCTATCAAAACCCCAATAAGG - Intergenic
957211129 3:77260204-77260226 TTCCCCCCAAAACTCACAAATGG - Intronic
960454199 3:117850367-117850389 TTCCTAACAAAACTAGAATAGGG - Intergenic
962204275 3:133422360-133422382 TACCTACCAGAATTCTAAAAGGG - Intronic
964638438 3:158882912-158882934 TTCTTTCCAAAACTTAAAAATGG + Intergenic
964728938 3:159844546-159844568 TTCCTCCCAAGACTGGAAAATGG - Intronic
964766232 3:160180762-160180784 ATCCTAACAAAACCCTAAAAGGG + Intergenic
965202049 3:165672184-165672206 TTCCCACCAAAACTGGACAAGGG + Intergenic
965815690 3:172634423-172634445 TCCCTACAAAACCCCCAAAAAGG + Intronic
967312498 3:188119243-188119265 TTCCTACAAATATTCCATAAAGG + Intergenic
967520591 3:190427782-190427804 TTGCTGCTAGAACTCCAAAATGG + Intergenic
970422624 4:15919507-15919529 TACTTACCAGGACTCCAAAATGG + Intergenic
971141578 4:23930702-23930724 TTCCTACCCAGACTCTCAAAGGG + Intergenic
971575916 4:28274332-28274354 ATTCTACCAAAAATACAAAAAGG - Intergenic
971897894 4:32620806-32620828 TTCCTACCAGCCCCCCAAAAAGG + Intergenic
972754807 4:42034886-42034908 TTCCTACCATCAGTGCAAAAAGG + Intronic
972860812 4:43167564-43167586 TTCCTACCAACAGTGTAAAAGGG + Intergenic
973247008 4:48019751-48019773 CTCCTTCCAAAACTCCACAAGGG - Intronic
973561551 4:52141812-52141834 TTTCTACCAACAATCCACAAGGG - Intergenic
973750714 4:54018064-54018086 ATTCTACCAAAAATCTAAAAGGG - Intronic
974337168 4:60564271-60564293 TTCCTACCAACAGTATAAAATGG + Intergenic
975242864 4:72082154-72082176 TTCCCATCACAACTTCAAAAAGG + Intronic
976004769 4:80416869-80416891 TTCCTATCCAGACTCCAAGAAGG + Intronic
976777256 4:88720245-88720267 TCCCTATCAATACTCCACAAAGG - Intergenic
977406087 4:96600767-96600789 TTTCGACTAAAATTCCAAAAAGG + Intergenic
978378588 4:108102377-108102399 ATCCTGCCAAAATTCCACAAAGG + Intronic
979386807 4:120076506-120076528 TTCCTTCCTATACTCCCAAAAGG + Intergenic
979551258 4:121993712-121993734 TTACTGGCAAAATTCCAAAAAGG + Intergenic
979779352 4:124630954-124630976 TTCCTACCAAAAATGCACAAGGG + Intergenic
980194023 4:129564831-129564853 TCCCAACCAAAATTCCTAAAAGG - Intergenic
980990936 4:139737805-139737827 TTCATAGCAGAGCTCCAAAAGGG + Intronic
981417924 4:144514915-144514937 TTCTCAGCAAAATTCCAAAATGG - Intergenic
983739327 4:171108505-171108527 TTCCCACCAACAGTACAAAAGGG - Intergenic
983745483 4:171192885-171192907 TCCCTACCCCCACTCCAAAATGG + Intergenic
985158849 4:187022868-187022890 TTTCTATCTAAACCCCAAAAAGG - Intergenic
985332038 4:188848395-188848417 TTCCTACCAAAAATACACAAGGG + Intergenic
985840016 5:2299026-2299048 ATCCTTCCAACACTCCAGAAAGG + Intergenic
985868828 5:2537996-2538018 TTTCTAATAAAACTACAAAAGGG - Intergenic
986042271 5:4005139-4005161 GTCTTACCAAAGCTCCAACAGGG + Intergenic
986307904 5:6529092-6529114 TTTCTAGCAAAAATCCCAAATGG - Intergenic
987211915 5:15692324-15692346 TTATTAGCAAAACTACAAAAAGG + Intronic
987379822 5:17275198-17275220 TTGCTTCCAGAACTCCAAGATGG + Exonic
988704314 5:33709236-33709258 TTCCTACCAACAGTGTAAAAGGG - Intronic
988784453 5:34553216-34553238 TTCCCACCAAGACATCAAAAGGG - Intergenic
989345807 5:40428169-40428191 ATCCTCACAAAACTCCATAAGGG + Intergenic
989598462 5:43179972-43179994 TTTCTACAAAAAATGCAAAAAGG - Intronic
989805859 5:45603102-45603124 TGCCTTCCTAAACTCCTAAAGGG - Intronic
991746123 5:69743349-69743371 TTTCTACCAAAATTCATAAACGG - Intergenic
991751582 5:69811892-69811914 TTTCTACCAAAATTCATAAACGG + Intergenic
991797725 5:70323307-70323329 TTTCTACCAAAATTCATAAACGG - Intergenic
991825501 5:70618663-70618685 TTTCTACCAAAATTCATAAACGG - Intergenic
991830869 5:70686785-70686807 TTTCTACCAAAATTCATAAACGG + Intergenic
991890069 5:71322628-71322650 TTTCTACCAAAATTCATAAACGG - Intergenic
992568828 5:78030844-78030866 TCTCTACCAAAAATCAAAAAGGG - Intronic
992608170 5:78483058-78483080 TTCCAAATAAAACTCCAAAAGGG - Intergenic
993172611 5:84438658-84438680 CTCCTACCATGACTCCAGAATGG + Intergenic
993851805 5:93019429-93019451 TTCCAAAGAAAACTTCAAAAAGG - Intergenic
994346220 5:98690147-98690169 TTCCTACCAACAGTGTAAAAGGG - Intergenic
995292499 5:110473461-110473483 TTCCTACCAACAGTGCATAAGGG - Intronic
998153970 5:139773924-139773946 TTCCTACCAACAGTGCACAAGGG + Intergenic
999190913 5:149746708-149746730 TTCCTACCAACAGTGCACAAGGG + Intronic
999312835 5:150563125-150563147 TTCTTACCAAAAATCTAAAGAGG + Intergenic
999562720 5:152822263-152822285 TTCCTATCAAAACCCCAGTAAGG + Intergenic
999614852 5:153412234-153412256 TACCTACCATAACTGCCAAATGG + Intergenic
1000718738 5:164679679-164679701 TTCTTTCCATAACTTCAAAATGG + Intergenic
1001392408 5:171389671-171389693 TACCTACCTAAATTCCCAAATGG - Intronic
1002534995 5:179871256-179871278 GTCCTGCCTAAACTCCAAGAGGG + Intronic
1003560990 6:7180237-7180259 TTCTTACCAAAAGGGCAAAAGGG - Intronic
1003617880 6:7671726-7671748 CTCCTACCAAAAAACCACAAGGG - Intergenic
1003801952 6:9680292-9680314 TTCTTACCAAAAGTGCACAAGGG + Intronic
1004069029 6:12279771-12279793 TTCCTTTCAACAGTCCAAAAAGG + Intergenic
1004701621 6:18085037-18085059 TTCTTACCACAACTTCATAACGG - Intergenic
1004957615 6:20747440-20747462 TTCCTACCAACAGTGCATAACGG + Intronic
1006852532 6:37109344-37109366 TCTCTACAAAAACTACAAAATGG - Intergenic
1008266967 6:49439614-49439636 TTGCTTCCAAAAATCCAAATAGG + Intronic
1008809535 6:55478935-55478957 TTTCTACCTAAATTCAAAAAGGG + Intronic
1009613811 6:65979812-65979834 TGCCTATCTAAAATCCAAAAGGG - Intergenic
1009918064 6:70021179-70021201 TTCCTAGCAAAACTCCGCAATGG - Intronic
1012682768 6:102203702-102203724 TTTCTAACAAAAGTACAAAAAGG - Intergenic
1013350474 6:109301404-109301426 TTCATAGCTAAAATCCAAAAAGG - Intergenic
1013799710 6:113928757-113928779 TTCCTACCAACAGTGCACAAGGG + Intergenic
1014924869 6:127258569-127258591 ATTCTACCAGAACTACAAAAAGG + Intergenic
1016001174 6:139042780-139042802 TTCCTACCAATGCTTCAAAGAGG - Exonic
1017212173 6:151868999-151869021 TTTCTCCCAAAGCACCAAAATGG + Intronic
1017401103 6:154064082-154064104 TTCCCACCAACAGTCCATAAGGG + Intronic
1021874819 7:25038550-25038572 TCTCTACCAAAAATACAAAAAGG + Intergenic
1022147597 7:27560913-27560935 TTCCTACCAACAGTGCAAAAGGG + Intronic
1022292553 7:29018014-29018036 TTTCTTCCAAAACTACAAGATGG - Intronic
1022819362 7:33943875-33943897 TTCTCACCAAACCACCAAAAGGG - Intronic
1024860925 7:53840348-53840370 TTCCCACCAACAATCCACAAGGG - Intergenic
1025116218 7:56260714-56260736 TTCCTACCAATAGTTCACAAGGG - Intergenic
1025717149 7:63969935-63969957 TTCCTACAACAAATGCAAAAAGG + Intergenic
1026501291 7:70945276-70945298 GTTGTACCTAAACTCCAAAATGG - Intergenic
1027593893 7:80148410-80148432 GTCCTACCGATTCTCCAAAAGGG - Intronic
1029199525 7:98829266-98829288 TTTCTACTAAAAATACAAAAAGG + Intergenic
1032103600 7:129005009-129005031 TACTTACCAAAACCTCAAAAAGG + Exonic
1032521545 7:132549385-132549407 TTCCTACCAAGACACCTCAAGGG - Intronic
1032674630 7:134117883-134117905 TTCTTACCAACACTGCACAAGGG - Intergenic
1035845338 8:2858032-2858054 TTACTATCAAAATCCCAAAATGG - Intergenic
1036375598 8:8196827-8196849 TTTCTACAAAAAATACAAAAAGG - Intergenic
1036853933 8:12226317-12226339 TTTCTACAAAAAATACAAAAAGG + Intergenic
1036875305 8:12468826-12468848 TTTCTACAAAAAATACAAAAAGG + Intergenic
1037467202 8:19172427-19172449 TCCCTACCAAAAATACAAAAAGG + Intergenic
1037682516 8:21109394-21109416 TTCCTACCAACAGTCTTAAAAGG + Intergenic
1039297861 8:36176624-36176646 GTCCTCCCAATACTCCAAACCGG - Intergenic
1039300861 8:36207199-36207221 TTCTTACCAAAATTCCAATGTGG - Intergenic
1039680373 8:39728971-39728993 TTCCCACCAACAGTCCAAAAGGG + Intronic
1041021068 8:53639303-53639325 ATTCTACCAAAGGTCCAAAAAGG - Intergenic
1041579710 8:59445099-59445121 TTCCTACAAGAAATCCTAAAAGG - Intergenic
1041857505 8:62475077-62475099 TCCCTCCCAAAACTACAAACTGG + Intronic
1042329518 8:67563564-67563586 TCCCTACCCAAACTCCAGATGGG - Intronic
1043781463 8:84340923-84340945 TTCCTACCAATACTGTATAATGG + Intronic
1045043741 8:98254060-98254082 TAGCCAGCAAAACTCCAAAAAGG + Exonic
1046438294 8:114224607-114224629 TTCCTGGAACAACTCCAAAATGG + Intergenic
1046501907 8:115088553-115088575 TTGCTAGCAAAAATGCAAAATGG - Intergenic
1047983379 8:130206835-130206857 TTAATACCAAAACCGCAAAATGG - Intronic
1050185945 9:2973648-2973670 GTCCTACCAGAAATCCAAAGGGG + Intergenic
1050613030 9:7372856-7372878 TTTCTACCATAACTCTGAAAAGG + Intergenic
1051692390 9:19729313-19729335 TTCCTCCAAAAACTACAAATAGG + Intronic
1051945322 9:22562626-22562648 TTCCCACCAACACTGCAAAAAGG - Intergenic
1052509290 9:29394140-29394162 TTCATATCAAAATTCCAGAAAGG + Intergenic
1052811580 9:33065621-33065643 TACCTTGCAAAACTCCAAAAAGG + Intronic
1053010999 9:34633340-34633362 TTCCTCCCAAACGTCCACAAAGG - Intergenic
1053521759 9:38787567-38787589 TTCCTACCAACAGTGTAAAAGGG - Intergenic
1054193926 9:62011556-62011578 TTCCTACCAACAGTGTAAAAGGG - Intergenic
1054644481 9:67577135-67577157 TTCCTACCAACAGTGTAAAAGGG + Intergenic
1054990756 9:71323529-71323551 TTCCACCCAAAACTGCTAAATGG + Intronic
1055219811 9:73915209-73915231 TTTCTTCCATAAGTCCAAAATGG + Intergenic
1055308718 9:74955887-74955909 TTATAACCAAAATTCCAAAAGGG - Intergenic
1055821792 9:80273963-80273985 TTCCTACCAACAATACAGAAAGG - Intergenic
1056080528 9:83089441-83089463 TCCCTACAAAAACACTAAAAGGG - Intergenic
1056658842 9:88530041-88530063 GTTCTGCCTAAACTCCAAAAGGG - Intergenic
1057475076 9:95392688-95392710 TTCCTATCAAAATCCCAACAAGG - Intergenic
1058016812 9:100042440-100042462 TTCCTACCAACAGTGCAAGAGGG - Intronic
1058246706 9:102635190-102635212 TTCCTACCAACAGTGTAAAAAGG - Intergenic
1058541234 9:106014560-106014582 TTTCTACCAAAAGTGGAAAAAGG - Intergenic
1058663308 9:107285051-107285073 TTTGTACCAAAATCCCAAAAAGG - Intronic
1059816040 9:117916631-117916653 TTCCTACCAACAGTTCACAAGGG - Intergenic
1186195180 X:7103930-7103952 TTCCCACCAAAAATCTATAAGGG - Intronic
1186665576 X:11713580-11713602 TTCCAAGCAAAACTCAAAACTGG + Intergenic
1186733486 X:12435816-12435838 TTCCTACAAAAACTCCCACTAGG - Intronic
1187379358 X:18786446-18786468 ATCCTCCCAAAAATCCAATATGG - Intronic
1188041441 X:25374421-25374443 TTCCTACTTAATCTACAAAATGG - Intergenic
1188076682 X:25785408-25785430 TTCCTACCAACAGTGCACAAGGG - Intergenic
1188678513 X:32972974-32972996 ATCCTATCAAATCTCCACAAAGG - Intronic
1190298976 X:49045043-49045065 TACCAATCAAAACTCTAAAACGG + Intergenic
1191290681 X:58795032-58795054 TTCCAACCAAACCTTCAAAGAGG - Intergenic
1191295506 X:58859245-58859267 TTCCAACCAAACCTTCAAAGAGG - Intergenic
1191307519 X:59018941-59018963 TTCCAACCAAACCTTCAAAGAGG - Intergenic
1191383422 X:60033645-60033667 TTCCAACGAAAACTTCAAAGAGG - Intergenic
1191430529 X:60664836-60664858 TTCCAACGAAAACTTCAAAGAGG - Intergenic
1191452600 X:60960039-60960061 TTCCAACCAAACCTTCAAAGAGG - Intergenic
1191556080 X:62344774-62344796 TTCCAACCAAACCTTCAAAGAGG - Intergenic
1192120944 X:68455035-68455057 TCTCTACAAAAACTACAAAAAGG + Intergenic
1193152714 X:78140986-78141008 TTCCTGCCCAAACTTCAAGATGG - Intergenic
1193180077 X:78444346-78444368 TTCTTACCAAAAATCCCAGATGG - Intergenic
1193194640 X:78617831-78617853 TTCCTACCAAAAATGCTACAGGG - Intergenic
1193694398 X:84689961-84689983 ATCCTAGCAAATCTCCAAACAGG + Intergenic
1193876307 X:86866778-86866800 TTCCCACAGAAACTCCAATAAGG + Intergenic
1194139787 X:90195647-90195669 ATTCTACCAAAGCTACAAAAGGG - Intergenic
1194279554 X:91932317-91932339 CTCTTTCCAAAACTCAAAAAGGG - Intronic
1194724835 X:97383395-97383417 TTCCTCACAAAACTCCTATAAGG + Intronic
1194921297 X:99768891-99768913 TAACAACCAAAAATCCAAAAAGG + Intergenic
1194929805 X:99873013-99873035 TTCCTACCAACAGTCTACAAGGG - Intergenic
1195550016 X:106157851-106157873 TTCCTCCTAAAACTGCAAAGGGG - Intergenic
1195994020 X:110713259-110713281 TCCCTACTAAAACTCCATGAAGG + Intronic
1195994757 X:110720630-110720652 TTCTTACTAAAAGTCCTAAAGGG + Intronic
1196141441 X:112267163-112267185 TTCTTAACAAAACTCCTCAAAGG + Intergenic
1196352920 X:114754251-114754273 TTCCTACCAAAACTCCAAAAAGG + Intronic
1197948547 X:131868948-131868970 TTCCTACCAAAAGTGCACAAGGG - Intergenic
1198784879 X:140276078-140276100 TTCCTACCAAAATACCAGTAAGG - Intergenic
1199474959 X:148234964-148234986 TTCCTACCAACACTGTAAAAGGG - Intergenic
1199634219 X:149800408-149800430 TTCCTCACAAAATTCCAAATAGG - Intergenic
1200485533 Y:3764616-3764638 ATTCTACCAAAGCTACAAAAGGG - Intergenic
1200597030 Y:5155808-5155830 CTCTTTCCAAAACTCAAAAAGGG - Intronic
1201499160 Y:14623031-14623053 TTTCTTTCAAAACTCAAAAAAGG - Intronic