ID: 1196357174

View in Genome Browser
Species Human (GRCh38)
Location X:114808845-114808867
Sequence ATTAATAAGCAGAATGTATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4286
Summary {0: 3, 1: 61, 2: 801, 3: 1324, 4: 2097}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196357174_1196357175 -9 Left 1196357174 X:114808845-114808867 CCTTATACATTCTGCTTATTAAT 0: 3
1: 61
2: 801
3: 1324
4: 2097
Right 1196357175 X:114808859-114808881 CTTATTAATGCCTTGTCAGATGG 0: 1
1: 28
2: 673
3: 1049
4: 1024
1196357174_1196357178 23 Left 1196357174 X:114808845-114808867 CCTTATACATTCTGCTTATTAAT 0: 3
1: 61
2: 801
3: 1324
4: 2097
Right 1196357178 X:114808891-114808913 AAATATTTTCTCCCAACCTGTGG 0: 4
1: 122
2: 1758
3: 3426
4: 4927
1196357174_1196357176 -8 Left 1196357174 X:114808845-114808867 CCTTATACATTCTGCTTATTAAT 0: 3
1: 61
2: 801
3: 1324
4: 2097
Right 1196357176 X:114808860-114808882 TTATTAATGCCTTGTCAGATGGG 0: 6
1: 417
2: 665
3: 599
4: 725

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196357174 Original CRISPR ATTAATAAGCAGAATGTATA AGG (reversed) Intronic
Too many off-targets to display for this crispr