ID: 1196368742

View in Genome Browser
Species Human (GRCh38)
Location X:114951974-114951996
Sequence AGGGAGAGCAAAGTGATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196368735_1196368742 9 Left 1196368735 X:114951942-114951964 CCACGCGAAGAGAGAATCCATGT No data
Right 1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG No data
1196368740_1196368742 -8 Left 1196368740 X:114951959-114951981 CCATGTGCTTGGGAGAGGGAGAG No data
Right 1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG No data
1196368733_1196368742 25 Left 1196368733 X:114951926-114951948 CCATCACCTCTGAGTGCCACGCG No data
Right 1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG No data
1196368730_1196368742 28 Left 1196368730 X:114951923-114951945 CCCCCATCACCTCTGAGTGCCAC No data
Right 1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG No data
1196368734_1196368742 19 Left 1196368734 X:114951932-114951954 CCTCTGAGTGCCACGCGAAGAGA No data
Right 1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG No data
1196368732_1196368742 26 Left 1196368732 X:114951925-114951947 CCCATCACCTCTGAGTGCCACGC No data
Right 1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG No data
1196368731_1196368742 27 Left 1196368731 X:114951924-114951946 CCCCATCACCTCTGAGTGCCACG No data
Right 1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196368742 Original CRISPR AGGGAGAGCAAAGTGATTGT GGG Intergenic
No off target data available for this crispr