ID: 1196369965

View in Genome Browser
Species Human (GRCh38)
Location X:114966546-114966568
Sequence ATGTCTCTGTTGAAGCATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196369963_1196369965 -4 Left 1196369963 X:114966527-114966549 CCAGTGTGCCTGAAGCAAAATGT No data
Right 1196369965 X:114966546-114966568 ATGTCTCTGTTGAAGCATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196369965 Original CRISPR ATGTCTCTGTTGAAGCATGA TGG Intergenic
No off target data available for this crispr