ID: 1196370172

View in Genome Browser
Species Human (GRCh38)
Location X:114968818-114968840
Sequence ATATATAGATTACTTTGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196370172_1196370176 8 Left 1196370172 X:114968818-114968840 CCTCCCCAAAGTAATCTATATAT No data
Right 1196370176 X:114968849-114968871 ATCCCAATACAAATATCAGCAGG No data
1196370172_1196370177 9 Left 1196370172 X:114968818-114968840 CCTCCCCAAAGTAATCTATATAT No data
Right 1196370177 X:114968850-114968872 TCCCAATACAAATATCAGCAGGG No data
1196370172_1196370181 26 Left 1196370172 X:114968818-114968840 CCTCCCCAAAGTAATCTATATAT No data
Right 1196370181 X:114968867-114968889 GCAGGGTTTTTTGTGGAAATTGG No data
1196370172_1196370180 19 Left 1196370172 X:114968818-114968840 CCTCCCCAAAGTAATCTATATAT No data
Right 1196370180 X:114968860-114968882 AATATCAGCAGGGTTTTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196370172 Original CRISPR ATATATAGATTACTTTGGGG AGG (reversed) Intergenic
No off target data available for this crispr