ID: 1196371321

View in Genome Browser
Species Human (GRCh38)
Location X:114982731-114982753
Sequence TCCCTTAGATGTACTCATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196371321_1196371329 22 Left 1196371321 X:114982731-114982753 CCCAAATGAGTACATCTAAGGGA No data
Right 1196371329 X:114982776-114982798 CACTCAAAGAAGGTGAAGACTGG No data
1196371321_1196371326 -9 Left 1196371321 X:114982731-114982753 CCCAAATGAGTACATCTAAGGGA No data
Right 1196371326 X:114982745-114982767 TCTAAGGGACACAGGGAGGCTGG No data
1196371321_1196371328 12 Left 1196371321 X:114982731-114982753 CCCAAATGAGTACATCTAAGGGA No data
Right 1196371328 X:114982766-114982788 GGTTCTGGAGCACTCAAAGAAGG No data
1196371321_1196371327 -3 Left 1196371321 X:114982731-114982753 CCCAAATGAGTACATCTAAGGGA No data
Right 1196371327 X:114982751-114982773 GGACACAGGGAGGCTGGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196371321 Original CRISPR TCCCTTAGATGTACTCATTT GGG (reversed) Intergenic