ID: 1196375750

View in Genome Browser
Species Human (GRCh38)
Location X:115030806-115030828
Sequence TCCCTCATTTGTTTGATCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196375750_1196375756 29 Left 1196375750 X:115030806-115030828 CCTTTGATCAAACAAATGAGGGA No data
Right 1196375756 X:115030858-115030880 GAGTAGCCCAAGGCCCTTGTTGG No data
1196375750_1196375752 -7 Left 1196375750 X:115030806-115030828 CCTTTGATCAAACAAATGAGGGA No data
Right 1196375752 X:115030822-115030844 TGAGGGAAACACCCTAGGCATGG No data
1196375750_1196375755 19 Left 1196375750 X:115030806-115030828 CCTTTGATCAAACAAATGAGGGA No data
Right 1196375755 X:115030848-115030870 AACAAGTTGAGAGTAGCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196375750 Original CRISPR TCCCTCATTTGTTTGATCAA AGG (reversed) Intergenic
No off target data available for this crispr