ID: 1196375752

View in Genome Browser
Species Human (GRCh38)
Location X:115030822-115030844
Sequence TGAGGGAAACACCCTAGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196375750_1196375752 -7 Left 1196375750 X:115030806-115030828 CCTTTGATCAAACAAATGAGGGA No data
Right 1196375752 X:115030822-115030844 TGAGGGAAACACCCTAGGCATGG No data
1196375747_1196375752 -4 Left 1196375747 X:115030803-115030825 CCACCTTTGATCAAACAAATGAG No data
Right 1196375752 X:115030822-115030844 TGAGGGAAACACCCTAGGCATGG No data
1196375745_1196375752 28 Left 1196375745 X:115030771-115030793 CCTGCTTGTTAGAATGTGGTCTT No data
Right 1196375752 X:115030822-115030844 TGAGGGAAACACCCTAGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196375752 Original CRISPR TGAGGGAAACACCCTAGGCA TGG Intergenic
No off target data available for this crispr