ID: 1196375753

View in Genome Browser
Species Human (GRCh38)
Location X:115030833-115030855
Sequence AACTTGTTCTGCCATGCCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196375753_1196375756 2 Left 1196375753 X:115030833-115030855 CCCTAGGCATGGCAGAACAAGTT No data
Right 1196375756 X:115030858-115030880 GAGTAGCCCAAGGCCCTTGTTGG No data
1196375753_1196375755 -8 Left 1196375753 X:115030833-115030855 CCCTAGGCATGGCAGAACAAGTT No data
Right 1196375755 X:115030848-115030870 AACAAGTTGAGAGTAGCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196375753 Original CRISPR AACTTGTTCTGCCATGCCTA GGG (reversed) Intergenic
No off target data available for this crispr