ID: 1196375756

View in Genome Browser
Species Human (GRCh38)
Location X:115030858-115030880
Sequence GAGTAGCCCAAGGCCCTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196375753_1196375756 2 Left 1196375753 X:115030833-115030855 CCCTAGGCATGGCAGAACAAGTT No data
Right 1196375756 X:115030858-115030880 GAGTAGCCCAAGGCCCTTGTTGG No data
1196375750_1196375756 29 Left 1196375750 X:115030806-115030828 CCTTTGATCAAACAAATGAGGGA No data
Right 1196375756 X:115030858-115030880 GAGTAGCCCAAGGCCCTTGTTGG No data
1196375754_1196375756 1 Left 1196375754 X:115030834-115030856 CCTAGGCATGGCAGAACAAGTTG No data
Right 1196375756 X:115030858-115030880 GAGTAGCCCAAGGCCCTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196375756 Original CRISPR GAGTAGCCCAAGGCCCTTGT TGG Intergenic
No off target data available for this crispr