ID: 1196376449

View in Genome Browser
Species Human (GRCh38)
Location X:115038397-115038419
Sequence GTAAAAAACAGGAAGGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196376444_1196376449 26 Left 1196376444 X:115038348-115038370 CCTCTCGGACAGGACAAAAGCAT No data
Right 1196376449 X:115038397-115038419 GTAAAAAACAGGAAGGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196376449 Original CRISPR GTAAAAAACAGGAAGGTGGG TGG Intergenic
No off target data available for this crispr