ID: 1196380403

View in Genome Browser
Species Human (GRCh38)
Location X:115083292-115083314
Sequence GCGCAATAAAAAATAATGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196380403_1196380406 23 Left 1196380403 X:115083292-115083314 CCCTTCATTATTTTTTATTGCGC No data
Right 1196380406 X:115083338-115083360 TTCTTTATTAGTCTTGCTAGTGG 0: 4899
1: 2647
2: 1728
3: 1345
4: 2229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196380403 Original CRISPR GCGCAATAAAAAATAATGAA GGG (reversed) Intergenic
No off target data available for this crispr