ID: 1196383023

View in Genome Browser
Species Human (GRCh38)
Location X:115114149-115114171
Sequence ACTAAGACATGGATCGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 122}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196383023 Original CRISPR ACTAAGACATGGATCGCAGA AGG (reversed) Intronic
900861378 1:5234964-5234986 ATTATGACATGGATGGAAGATGG + Intergenic
902656713 1:17874117-17874139 ACTAAGACATGGAGGGATGAAGG + Intergenic
905908712 1:41639194-41639216 TCTAAGACATGGGTCACACATGG + Intronic
908737435 1:67291184-67291206 ACTAGGACCTGGTTCACAGATGG + Intergenic
909548898 1:76876814-76876836 ACTAAGGCCTGGTTCACAGATGG - Intronic
912460062 1:109824503-109824525 GCTAAGACATGCATAGAAGAAGG - Intergenic
913387529 1:118275975-118275997 ACTAAGACAGGGATCCCCTACGG + Intergenic
914903658 1:151726822-151726844 GCTAAAAGATGGACCGCAGATGG - Intronic
917666918 1:177234055-177234077 ATTAAGAGATGGATCTGAGAAGG - Intronic
917764577 1:178202380-178202402 ACTAAGGCCTGGTTCACAGATGG + Intronic
918582485 1:186147209-186147231 ACTAAGCCAGGGAGGGCAGAAGG - Intronic
922251134 1:223849565-223849587 ACTCAAACATGGCTCTCAGAAGG + Intergenic
923664881 1:235991051-235991073 ACTCAGACCTGCATGGCAGAGGG + Exonic
1064338434 10:14464993-14465015 ACTCAGAAATGGATGGCACATGG + Intergenic
1065973295 10:30822075-30822097 GCTCAGCCATGGATTGCAGAGGG - Intronic
1066504076 10:36023853-36023875 ACAAGGACATGGATCAGAGAGGG - Intergenic
1071049192 10:81425972-81425994 ACTAAAACATGGTTATCAGAGGG + Intergenic
1074662416 10:115676388-115676410 TATAAGACATGTATTGCAGATGG - Intronic
1076274059 10:129181780-129181802 AGTAAGGCAGGGACCGCAGAGGG - Intergenic
1077898174 11:6469561-6469583 ACCAATACAGGGATAGCAGAAGG - Intronic
1078117676 11:8470183-8470205 CCTAAGACATTGATAGAAGATGG - Intronic
1078123021 11:8529733-8529755 CATAAGCCATGGATCGCAGGTGG + Intronic
1081828154 11:46079303-46079325 CCTATTACATGGATCACAGAAGG - Intronic
1083425249 11:62581015-62581037 ACTAAGACATGGAGAGCTAAAGG + Intronic
1083720197 11:64600114-64600136 ACTAAGTGATGGATTGCAGGAGG + Intronic
1084914189 11:72415700-72415722 AAGAAGTCATGGATCTCAGAAGG + Intronic
1088097256 11:106115503-106115525 ACTAGGGCCTGGTTCGCAGATGG + Intergenic
1089388790 11:118085960-118085982 ACAAAGAGAAGGATCGCAGAGGG + Intronic
1090066360 11:123507137-123507159 ACAAACACATGGAGAGCAGAAGG - Intergenic
1094473444 12:30823720-30823742 ACAAAGACTTGGCTCACAGAGGG + Intergenic
1095321825 12:40837823-40837845 ACTGAGACATGGATGCCAGCTGG + Intronic
1095900597 12:47324330-47324352 ACTAAGAAAAGGAAGGCAGAGGG - Intergenic
1096964398 12:55613852-55613874 ACAAAGACATGAATATCAGAAGG + Intergenic
1102052176 12:109870753-109870775 ATTAAGACAGAGATCTCAGAAGG + Intronic
1103248087 12:119475382-119475404 ACTGAAACATGGATTGGAGAGGG - Intronic
1103449825 12:121020793-121020815 ACGAAGACCTGGATCTCGGAGGG + Exonic
1105968139 13:25403353-25403375 ACTAAGACAAAGGTCCCAGATGG + Intronic
1107429247 13:40324656-40324678 ACAAAGATAAGGATGGCAGAAGG - Intergenic
1108240197 13:48456675-48456697 AGTCAGACATGGAACGGAGAGGG + Intronic
1108267587 13:48728219-48728241 AATAAGAAATGGACCTCAGAAGG + Intergenic
1108737086 13:53295480-53295502 ACTAAGGCAAGGAATGCAGAAGG - Intergenic
1108904329 13:55450316-55450338 ACTAGGACCTGGTTCACAGATGG + Intergenic
1110834088 13:80064283-80064305 ACTAGGACCTGGTTCACAGATGG - Intergenic
1112260472 13:97873560-97873582 AGAAAGAAATGGATGGCAGATGG + Intergenic
1112872653 13:103993932-103993954 AGCAAGACATGGATGGCAGAAGG - Intergenic
1114365281 14:22019935-22019957 ACTAAGAAATTCATGGCAGAAGG - Intergenic
1116723757 14:48534217-48534239 ACTAAAACAGTGATGGCAGAAGG + Intergenic
1120555940 14:85930093-85930115 ACTAGGGCCTGGTTCGCAGATGG - Intergenic
1121864042 14:97346080-97346102 ACTTAGCCATGGAGCCCAGATGG + Intergenic
1122818335 14:104326411-104326433 ACTGAGACCTGGACCCCAGAGGG - Intergenic
1123020308 14:105394909-105394931 GCTGAGCCATGGATCGCGGAAGG + Exonic
1123765578 15:23474962-23474984 GCTAAAACATGGATCAAAGATGG - Intergenic
1126477996 15:49087484-49087506 AGTAAGAAATGAATAGCAGAAGG + Intergenic
1126988975 15:54348995-54349017 ACTAAGACAAGGAGCACATAAGG - Intronic
1129256506 15:74336994-74337016 ACTTAGACTTGGATAGCCGAGGG + Intergenic
1129534387 15:76300116-76300138 ATTAAGCCATGGAAGGCAGAAGG - Intronic
1131205388 15:90441275-90441297 TCCCAGACATGGATCACAGATGG + Intronic
1139159076 16:64481350-64481372 AATAAGATATGGATCAAAGATGG + Intergenic
1146238033 17:31186295-31186317 ACTAGGGCCTGGTTCGCAGATGG + Intronic
1148966254 17:51438450-51438472 AATGAGACATGGATGCCAGAGGG - Intergenic
1149441908 17:56681382-56681404 ACAAAGACATGGATTTCAGGAGG - Intergenic
1158204743 18:54980227-54980249 ACAAAGACATGGATACCAGGAGG + Intergenic
1166647783 19:44544981-44545003 AATAAGAAAAGGATCTCAGAAGG + Intergenic
1167951984 19:53035303-53035325 ACCCAGACATGGATTGGAGATGG - Intergenic
925296134 2:2778828-2778850 ACTAAGACATGGAGGCCAGAGGG - Intergenic
930107542 2:47651731-47651753 AAAAAGACATGGATTTCAGATGG - Intergenic
930536563 2:52651922-52651944 ACTAGGACCTGGTTCACAGATGG - Intergenic
933394423 2:81713012-81713034 ACTAAGGCCTGGTTCACAGATGG - Intergenic
934581424 2:95444007-95444029 ATTAATACATGGATTACAGAAGG + Intergenic
934598026 2:95632707-95632729 ATTAATACATGGATTACAGAAGG - Intergenic
937852522 2:126648394-126648416 ACTAAGGCCTGGTTCACAGATGG - Intergenic
939427954 2:142065243-142065265 AATCTGACATGGATCTCAGAGGG + Intronic
940472039 2:154112783-154112805 ACTAGGACATGCTTCACAGATGG - Intronic
940832951 2:158488636-158488658 ACTAAGGCATGGATTCCAGGAGG - Intronic
944990949 2:205234932-205234954 AATAACACATGGATCAAAGAAGG + Intronic
947440891 2:230120594-230120616 ACTAGGGCATGGTTCACAGATGG + Intergenic
1170243353 20:14194175-14194197 CTGAAGACATGGATCTCAGAAGG + Intronic
1173097043 20:40044153-40044175 ATTAAGACATGGATACCACATGG + Intergenic
1173702679 20:45086734-45086756 ACCAGGACATAGATGGCAGAGGG - Intergenic
1179415105 21:41192195-41192217 ACTAGGACTTGGTTCACAGATGG - Intronic
1181420704 22:22796173-22796195 ACTAGGGCCTGGATCACAGATGG + Intronic
956849918 3:73219563-73219585 ACTCAGACAGGGATATCAGATGG - Intergenic
959745965 3:109776930-109776952 ACTAGGACCTGGTTCACAGATGG - Intergenic
965546414 3:169920824-169920846 ACTCAAACATTGATCCCAGATGG + Intronic
971233805 4:24823053-24823075 AGTAAGACATGGGTCTAAGAAGG - Intronic
973036483 4:45413651-45413673 GCTAAAACATGGATCAAAGATGG + Intergenic
976748411 4:88429353-88429375 CAAAAGACATGGATCACAGAGGG + Intronic
978889265 4:113803307-113803329 ACAAAGTCATGAATAGCAGAAGG + Intergenic
979482117 4:121231416-121231438 ACTCTGACATGGATAGCAAAGGG + Intergenic
980425357 4:132620600-132620622 GCTAAGACAAGGATGACAGAAGG - Intergenic
983027446 4:162755633-162755655 ACTAAGGCCTGGTTCACAGATGG + Intergenic
984155450 4:176190939-176190961 ATTAGGACATGGATAGCAGGGGG + Intronic
984477387 4:180254171-180254193 ACTAAGACATGGGATGGAGATGG - Intergenic
986359590 5:6963722-6963744 ACCATGACATGGATGGCAGCTGG + Intergenic
987153226 5:15062009-15062031 ACTAGGGCCTGGTTCGCAGATGG + Intergenic
993231860 5:85247196-85247218 ATTAAGACCTGGCTCACAGATGG - Intergenic
993301204 5:86213206-86213228 GCTAAGTCATAGATCACAGAGGG - Intergenic
996904417 5:128581805-128581827 AATAATAGATGGATGGCAGATGG + Intronic
1000742758 5:164990381-164990403 ACTAAGAGATGGATTGCCCACGG + Intergenic
1003365647 6:5472293-5472315 AATTAGTCATGGATCGCTGAAGG + Intronic
1004324291 6:14659983-14660005 ACTAAGCCAGGTATTGCAGATGG - Intergenic
1004533073 6:16472788-16472810 GATAAGACATGGCACGCAGAGGG + Intronic
1007796876 6:44356156-44356178 ACTGAGACAAGGAACACAGAAGG - Intronic
1012344631 6:98170664-98170686 ACTAAGGCCTCGTTCGCAGATGG + Intergenic
1012944806 6:105453851-105453873 ACTAAGACATAGATCTCTTAGGG + Intergenic
1013769481 6:113611627-113611649 ACTAACACATGGCCAGCAGAAGG - Intergenic
1015633009 6:135249734-135249756 ACTAAGCCTTGGTTAGCAGAAGG - Intergenic
1018778460 6:167041439-167041461 ACTAAGACATGAAGAGCTGAAGG - Exonic
1020147814 7:5658198-5658220 ACTAAGACGTAGATCCCAGTAGG - Intronic
1021016586 7:15543100-15543122 ACTAATAAATAGATGGCAGATGG - Intronic
1033050143 7:137996664-137996686 AGTAAGACATGGAAGCCAGATGG + Intronic
1033076305 7:138253389-138253411 ACTAGGACTTGGTTCACAGATGG + Intergenic
1039386324 8:37139051-37139073 ACTTAGACATTCATGGCAGAGGG - Intergenic
1043241392 8:77939367-77939389 GTTAAGACATGGATGGCAGCAGG + Intergenic
1044838999 8:96322228-96322250 ACTAAGACAGGGACCAGAGAGGG - Intronic
1050735830 9:8761949-8761971 ATTAACACATGAATCACAGAGGG + Intronic
1051114411 9:13677723-13677745 ACTAAGAGATGGATACCAAAAGG - Intergenic
1059904541 9:118967791-118967813 ACTAAGACATAGCTCACGGAAGG - Intergenic
1061052452 9:128204413-128204435 ACTAAGACAGGGATGGCGGGAGG + Intronic
1186115713 X:6303406-6303428 ACTAAGACAATGATTGAAGAGGG - Intergenic
1186472661 X:9833550-9833572 ACTAGGACATTGAGCGCTGAAGG + Intronic
1191719193 X:64215364-64215386 ACTAGGACCTGGTTCACAGATGG - Intergenic
1191832690 X:65431981-65432003 ACTCAGGCATGGATTACAGATGG - Intronic
1191946398 X:66539353-66539375 ACTAGGACCTGGTTCACAGATGG + Intergenic
1196072171 X:111537942-111537964 AATAATACATGGATCAAAGAAGG + Intergenic
1196383023 X:115114149-115114171 ACTAAGACATGGATCGCAGAAGG - Intronic