ID: 1196384691

View in Genome Browser
Species Human (GRCh38)
Location X:115136672-115136694
Sequence CTGCTCTTTGTTTTCTACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 280}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196384691_1196384694 10 Left 1196384691 X:115136672-115136694 CCTGTGTAGAAAACAAAGAGCAG 0: 1
1: 0
2: 1
3: 34
4: 280
Right 1196384694 X:115136705-115136727 CTAGTGAGGAAAGTGAATTTTGG 0: 1
1: 0
2: 1
3: 21
4: 213
1196384691_1196384695 14 Left 1196384691 X:115136672-115136694 CCTGTGTAGAAAACAAAGAGCAG 0: 1
1: 0
2: 1
3: 34
4: 280
Right 1196384695 X:115136709-115136731 TGAGGAAAGTGAATTTTGGCAGG 0: 1
1: 0
2: 0
3: 38
4: 322
1196384691_1196384693 -4 Left 1196384691 X:115136672-115136694 CCTGTGTAGAAAACAAAGAGCAG 0: 1
1: 0
2: 1
3: 34
4: 280
Right 1196384693 X:115136691-115136713 GCAGTTTAATGAGGCTAGTGAGG 0: 1
1: 0
2: 0
3: 8
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196384691 Original CRISPR CTGCTCTTTGTTTTCTACAC AGG (reversed) Intronic
900656484 1:3761259-3761281 CTGCCCTTGGTTTTCTGCCCAGG + Exonic
900769610 1:4530144-4530166 CTGCCTTTAGTTTTCTACTCAGG - Intergenic
901658847 1:10786259-10786281 TTGCTCTTTCTTTCCCACACTGG - Intronic
902840127 1:19069021-19069043 CTGCTCTGTGTTTCCTGCCCTGG - Intergenic
902938162 1:19779707-19779729 CTCGTCTTTGTTTCCTCCACAGG + Intronic
905811769 1:40918342-40918364 ATGTTCTTTCTTTCCTACACTGG - Intergenic
908027317 1:59966665-59966687 CTGCTTTTTGTTTTCTTAATTGG - Intergenic
908650347 1:66326173-66326195 CTGCTCTTGTTTTTTTAAACTGG + Intronic
909232798 1:73113220-73113242 CTGCTCTTTTTTTTCCTTACTGG - Intergenic
909671404 1:78193063-78193085 TTGCACTTTTTTTTCTAAACAGG + Intergenic
911140447 1:94495714-94495736 CTGCTCTTTGTGGTTTACAATGG - Intronic
913574845 1:120161880-120161902 CTGCACCTTGCTTTCTGCACTGG + Intronic
914296110 1:146326720-146326742 CTGCACCTTGCTTTCTGCACTGG + Intergenic
914448551 1:147771216-147771238 CTGCTCTTCATCGTCTACACTGG - Intronic
914557152 1:148777510-148777532 CTGCACCTTGCTTTCTGCACTGG + Intergenic
914615682 1:149352720-149352742 CTGCACCTTGCTTTCTGCACTGG - Intergenic
915463915 1:156084900-156084922 CTGCCCTTTGTTTTCCTCCCTGG - Intronic
915737046 1:158091607-158091629 CTGCTCCTTCTTTTCTCCAGGGG + Intronic
915854762 1:159371141-159371163 CTGCTATTTGTTTGCTATATTGG - Intergenic
918155340 1:181839969-181839991 CTGCCCTTTGTTTTCCACAGAGG - Intergenic
918293274 1:183130470-183130492 CCGCTCTGTGTTCTCTACATGGG - Exonic
919527909 1:198677919-198677941 CAGCTTTTTTTTTTCCACACAGG + Intronic
920103607 1:203534684-203534706 CTGCTCTGTGTTTTCTCAAATGG - Intergenic
922907136 1:229182700-229182722 TTGGTCTTTTTTTTCTATACTGG - Intergenic
923274540 1:232385064-232385086 CTGCACCTCCTTTTCTACACTGG - Intergenic
924076400 1:240342218-240342240 CTGCTCTGTGTTTTCAACAGAGG + Intronic
924390744 1:243553150-243553172 CTGCCCCTTTTTTTGTACACTGG - Intronic
924904754 1:248440596-248440618 CAGCTCTTTTTATTCAACACAGG + Intergenic
924923133 1:248651453-248651475 CAGCTCTTTTTATTCAACACAGG - Intergenic
1062924808 10:1308113-1308135 CTGCTCTGTGTGTACTACAGTGG - Intronic
1063449467 10:6141806-6141828 GTTCTTTTTTTTTTCTACACAGG + Intergenic
1064404031 10:15045124-15045146 CTGGGTTTTGTTTTCAACACTGG - Intronic
1066702238 10:38142473-38142495 CTTCTCATTGTTCTCTACATGGG + Intergenic
1068593908 10:58881521-58881543 CTGCACTTTTTTTTCTAAATGGG - Intergenic
1069140826 10:64823003-64823025 CTTCTCTTTGCTTTCAAGACTGG - Intergenic
1069291143 10:66781170-66781192 CTGCTGTTTGAATTCCACACAGG - Intronic
1072231617 10:93418573-93418595 CTGGGCTTTGTTATCTAGACTGG - Intronic
1072525232 10:96265461-96265483 CTGCTCTCACTTTTCTACCCAGG + Intronic
1073503083 10:103959840-103959862 CTGCACTTTGTGTCTTACACAGG - Intergenic
1073680933 10:105702784-105702806 TTGCTCTTTTTTTTTCACACTGG - Intergenic
1073898236 10:108187590-108187612 CTGCTGTGTGTTGTCTACTCTGG - Intergenic
1074031411 10:109692476-109692498 CAGATCATTCTTTTCTACACTGG + Intergenic
1079423779 11:20319836-20319858 CTGCTCTTGTTTCTCTCCACTGG - Intergenic
1079930953 11:26559697-26559719 TTTCTGTTTGTTTTCTACTCAGG + Exonic
1080049185 11:27841648-27841670 GTGTGCTTTGTTTTCTACAAAGG - Intergenic
1080066609 11:28023014-28023036 CTGCTCTCTGTATTCATCACAGG + Intronic
1080425656 11:32151663-32151685 CAGCTCTCTTTTTTCTTCACTGG - Intergenic
1080704184 11:34673727-34673749 CAGCTCTTTCTTGACTACACTGG + Intergenic
1081505173 11:43708979-43709001 CTGCCCTGTGTTTTCTCCACTGG - Intronic
1083564117 11:63698520-63698542 CTTCTTTCTGTTTTCTTCACTGG + Intronic
1085066199 11:73498254-73498276 CTGCTCTTCCTTTTCTCCATGGG - Intronic
1085169137 11:74433419-74433441 CTGTTTTTTGTTTTTTAGACAGG - Intergenic
1085546811 11:77326677-77326699 CTGCTCTGTTTTTTCGAGACAGG - Intronic
1085810289 11:79673957-79673979 CTGCTCCATGTTTTCCATACAGG + Intergenic
1087734603 11:101817744-101817766 CTGTTCTTTGTTTTCCCCAGGGG - Intronic
1087843200 11:102941284-102941306 CTGCACTTTTTTTTCTAAACGGG + Intergenic
1089803745 11:121063659-121063681 ATGCTCTCATTTTTCTACACTGG + Intronic
1090647222 11:128776138-128776160 CTGCTATTTCTTCTCTACCCTGG - Intronic
1090886739 11:130883745-130883767 TTGCACTTGGTCTTCTACACAGG - Intronic
1091946809 12:4553097-4553119 CTTCTCTTTCTTTTCTACTGGGG - Exonic
1092112177 12:5971492-5971514 CTGCCCTTTGCTTTCCCCACTGG - Intronic
1092973869 12:13725210-13725232 CTGCTCTTTGATTTCCCCAGAGG - Intronic
1093549757 12:20393807-20393829 TGGCTCTTTGTCTTCTACAAGGG + Intronic
1093636881 12:21481256-21481278 CTGCTCTTTTTCTTCTCAACTGG - Intronic
1094795124 12:33963053-33963075 CTGCACTTTTTTTTCTAAATGGG - Intergenic
1096834148 12:54337921-54337943 CTGCTCTTGGTTCTTTTCACTGG - Intronic
1097305584 12:58065571-58065593 GTCCTCTTTGTTTTTTAAACTGG + Intergenic
1097928124 12:65153947-65153969 CATGTCTTTTTTTTCTACACTGG - Intergenic
1098724685 12:73948266-73948288 ATGTTGTTTGTTTTCTATACAGG - Intergenic
1099153493 12:79145035-79145057 ATGTTCTTTATTTTCTATACAGG - Intronic
1099165503 12:79301813-79301835 TTCCTCTTTGATTTCTACTCAGG + Intronic
1099743510 12:86671322-86671344 CTGCACTTTTTTTTCTAAATGGG + Intronic
1099916467 12:88901102-88901124 CTACTCTGTGTTGTCTACAAAGG + Intergenic
1100047222 12:90397781-90397803 ATGCTCTGGGTTTTCTACCCTGG + Intergenic
1100085112 12:90901206-90901228 CTGCTCTTGGTTTTATACCCTGG - Intergenic
1103267339 12:119641886-119641908 CTGCTCTTTCTTTGCTAAAAAGG - Exonic
1103722823 12:122983724-122983746 CTTCTCTTTGATTTCTAAAGAGG - Exonic
1104427832 12:128692744-128692766 CTGCTGTTTCCTTGCTACACTGG + Intronic
1104594070 12:130108068-130108090 CTGCACTTTTTTTTCTAAACAGG + Intergenic
1105982248 13:25529777-25529799 GTGGTCTTTGTTTTCTACATTGG - Intronic
1107629085 13:42325050-42325072 TTACTATTTGTTTTCTACTCAGG - Intergenic
1110290111 13:73795759-73795781 AAGCTCCTTGTTTTCTACTCGGG + Intronic
1110940513 13:81342977-81342999 CTGGTCTTTGTGCTCCACACTGG - Intergenic
1113131017 13:107037143-107037165 CTGCTGTTTGTTCCCCACACAGG + Intergenic
1114755175 14:25251688-25251710 GTGCTCTTTTTTTTCTAGACAGG - Intergenic
1116330438 14:43590458-43590480 TTTCTCTTTCTTTTCTTCACTGG + Intergenic
1116769627 14:49112038-49112060 CTGATCTTGGTTTTCTCCTCTGG + Intergenic
1117027551 14:51636862-51636884 CTGGTCTTTTTTCTCTACAGTGG - Intronic
1117701480 14:58417746-58417768 CTGCTCTTTATTTCCTTCATTGG - Intronic
1118035451 14:61861416-61861438 CTCCTTTTTGTTTTCGAGACAGG + Intergenic
1118684446 14:68277279-68277301 CTTCTCCTTTTTCTCTACACAGG - Intronic
1119764667 14:77181083-77181105 CTGCCCCTTGTTTTGCACACTGG + Intronic
1120373098 14:83664311-83664333 TTACTCTTTGTTGTCAACACAGG + Intergenic
1120821586 14:88916180-88916202 TTCCTCTTTGTTTTCTACTGTGG - Intergenic
1126271819 15:46828184-46828206 CTGGTGTTTCTTTTCTTCACTGG + Intergenic
1127798293 15:62456625-62456647 CAGCTCTGTGTCTCCTACACAGG - Intronic
1129579702 15:76794607-76794629 CTGCTTTCTGTTTTCTTCAGTGG - Intronic
1130418498 15:83716742-83716764 CTGTTCTTTGTTTTGGACCCTGG + Intronic
1132058994 15:98675762-98675784 GTGCTGTTTTTTTTCTTCACTGG + Intronic
1139246162 16:65446543-65446565 CTGCTCTGTGTTTTCAACATGGG + Intergenic
1139364550 16:66425852-66425874 CTGGGGTTTGTTTTCTCCACCGG + Intergenic
1142122035 16:88391258-88391280 CGGCTCTTTCCTTTCTCCACGGG - Intergenic
1146426280 17:32742378-32742400 ATGCTGTTTGGTTTCTACACTGG + Intronic
1148403996 17:47395426-47395448 CTTCTTTTTGTTGTCTACAGTGG + Intronic
1149262769 17:54897667-54897689 GTTATCTTTGTTTTCTATACAGG + Intergenic
1149789168 17:59462328-59462350 CAGATTTTTTTTTTCTACACGGG + Intergenic
1150756018 17:67914647-67914669 CTGCTCTTTGTATTCTAAAATGG + Intronic
1152224720 17:79087424-79087446 CTGCTCTTTCTTCTCTGCCCAGG + Intronic
1153446025 18:5174036-5174058 CTGCTCTTTGCTTCCTGCCCTGG + Intronic
1155817989 18:30339473-30339495 CTGCACTTTTTTTTCTACATGGG - Intergenic
1156401092 18:36741395-36741417 CTCCTCCTTTTCTTCTACACTGG - Intronic
1157921350 18:51715841-51715863 CTGCTCTGTGTTGTATAAACTGG - Intergenic
1158160679 18:54479518-54479540 CTGGGCTTTGTTTTCTGCTCTGG + Intergenic
1159457255 18:68675857-68675879 CTGATCTCTTTTTTTTACACCGG + Exonic
1160161941 18:76479960-76479982 CTGCTATTTGTTTTCAAACCAGG - Intronic
1162649045 19:12071476-12071498 CTGCACTTTTTTTTCTAAATGGG + Intronic
1163393944 19:17047843-17047865 CTGCTCTATGTTTTCTGAATTGG - Intergenic
1163746955 19:19054411-19054433 CTGCACTTTGGTTCCGACACTGG - Intronic
1164464770 19:28478198-28478220 CAGCTCTCTGTCTTCTACATTGG - Intergenic
1164552771 19:29225553-29225575 CTGGTCTTTGTTTCTTACTCCGG + Intergenic
1164876138 19:31691651-31691673 CTGGTCTTTGTTTTCTCCCCGGG + Intergenic
1166153273 19:40890829-40890851 CAGCTCTGTCTTTTCTTCACTGG - Intronic
1166175152 19:41062812-41062834 CAGCTCTGTCTTTTCTTCACTGG + Intergenic
1167344010 19:48933971-48933993 CTGATCTTTCTTTTCCCCACAGG - Intronic
1167452769 19:49581810-49581832 CTGCTCCTTGCTTTCTTCTCTGG + Intronic
1167734785 19:51287274-51287296 CTGCTCTTTGTTTTCATCATAGG + Intergenic
1167998000 19:53422163-53422185 CTGGTCTTTATATTTTACACAGG - Intronic
1168368230 19:55807959-55807981 CTGCTCTCTTTTTTATACAATGG - Exonic
927260385 2:21082363-21082385 CTGAGCTTTATTTTCTTCACAGG - Intergenic
928762551 2:34601907-34601929 CTGAACTTTGTTTTCAACTCTGG - Intergenic
928925142 2:36571060-36571082 CTACACTTTGTTTTCTGCAATGG - Intronic
929074965 2:38073699-38073721 CTGCTTCTTGTCTTCTACCCCGG + Intronic
929846943 2:45540477-45540499 TTGCTTTTTGTTTTCTATTCTGG - Intronic
930257113 2:49105226-49105248 CTGCCCCTTGTTTTCAACATAGG - Intronic
932006993 2:67937189-67937211 CTGCTTTTTGTTTTCCACCACGG + Intergenic
932528762 2:72502723-72502745 CTGCTCTTTTTTCACTACACTGG + Intronic
932806752 2:74791146-74791168 CGGCACTTTTTTTTCTAAACGGG - Intergenic
935699297 2:105797289-105797311 CTGATTTTTCTTTTCTGCACAGG + Intronic
936083051 2:109448093-109448115 CTGGTCCTTGGTTTCCACACTGG - Intronic
938179790 2:129170038-129170060 TGGCTCTTTTTTTTCCACACTGG - Intergenic
940839671 2:158565501-158565523 CTGCTCTTTTTTTGGTAAACAGG + Intronic
941400886 2:165029737-165029759 CTTCTTTTTGTTTTCTAATCAGG - Intergenic
942921218 2:181375691-181375713 GTACTATTTGTTTTCTATACAGG - Intergenic
943438707 2:187899493-187899515 CTGTTCTTTTTTTTCTACCCAGG + Intergenic
945675520 2:212851310-212851332 CTCCTCTTTGTCTTCTTCAGTGG - Intergenic
946975441 2:225143279-225143301 CTGCACTTTTTTTTCTGTACAGG - Intergenic
948057627 2:235020489-235020511 CTGCTCTTTTTTTTCCAGACAGG - Intronic
948058604 2:235027571-235027593 CCGCTTTTTGTTTTCTAACCCGG + Intronic
948472234 2:238190958-238190980 CTTCTTTTTGTTTTTGACACAGG + Intronic
1168796182 20:611530-611552 CTGCGCTCTGTCTGCTACACCGG - Intergenic
1168820532 20:770059-770081 CTGCACTTTTTTTTCTAAACAGG - Intergenic
1170324246 20:15138447-15138469 CTACTCTTTGAATTTTACACTGG - Intronic
1171024448 20:21616004-21616026 CAGCTCTTTGTTCTCTCCATGGG - Intergenic
1172572252 20:35979847-35979869 CTCCCCTTTGTTCTCTACTCTGG - Intronic
1173064741 20:39699563-39699585 CTTCTCTTTGTTTTCCACCATGG - Intergenic
1175296385 20:57911733-57911755 CTGCCCTTGGTTTTATACCCTGG + Intergenic
1175702526 20:61150540-61150562 CTGCTCTCTGCTTTCCAAACGGG + Intergenic
1175836062 20:61995439-61995461 CTTCTCTTTGTTTTCCAGACTGG - Intronic
1177228335 21:18286263-18286285 CTTCTCTTTTATATCTACACTGG + Intronic
1177344053 21:19845614-19845636 CTGCTCTTTGCTAAATACACAGG + Intergenic
1177679651 21:24349501-24349523 CTGCATTTTTTTTTCTAAACAGG + Intergenic
1177897421 21:26870898-26870920 CTGCACTTTTTTTTCTAAACCGG - Intergenic
1178000388 21:28155604-28155626 CTGCCCTTGGTTTTCAAAACAGG + Intergenic
1179265335 21:39797978-39798000 CGGCACTTTGTTTTCTTCAGGGG + Intronic
1179327837 21:40366966-40366988 TTACTCTTTGTATTCTACTCTGG + Intronic
1181390741 22:22579227-22579249 TTGCTCCTTGTTTCCTCCACAGG + Intergenic
1181425448 22:22834692-22834714 CTGCCCTTCATTTTCTCCACAGG + Intronic
1181429691 22:22871563-22871585 CTGCCCTTCATTTTCTCCACAGG + Intronic
1183263800 22:36813508-36813530 CTGCTTTTTGTCTTCTAATCTGG + Intronic
1184121038 22:42450538-42450560 CTGTTCTTCGTTTTCTGCAATGG - Intergenic
1184132871 22:42528264-42528286 CTGTTCTTCGTTTTCTGCAATGG - Intergenic
951544047 3:23807427-23807449 GTGCTCTTTTTTTTTTCCACAGG + Intronic
951940107 3:28068653-28068675 CTCCTATTTGCTTACTACACAGG - Intergenic
951989967 3:28665617-28665639 GTGCCCTTTATTTCCTACACAGG + Intergenic
952363919 3:32658243-32658265 TTGCTTTTTGTTTTCAAGACAGG + Intergenic
952407220 3:33015421-33015443 CTGCTCTATTTGTTCCACACAGG + Intronic
952620229 3:35329140-35329162 ATGCTGTATGTTTTCTACAATGG - Intergenic
955546985 3:60041519-60041541 GTGCTCCTTGTTTTCTCCACTGG - Intronic
958600886 3:96295736-96295758 GTTATCTTTGTTTTCTTCACAGG + Intergenic
959418472 3:106104827-106104849 CTGCTCTTCTTTTTCTTCATAGG + Intergenic
959946063 3:112126513-112126535 CTGCAATTTGTTTTCTGCACAGG + Intronic
960629200 3:119712001-119712023 CTGCTCTATGTGTTCTATCCAGG - Intronic
961830490 3:129620683-129620705 CTGCTTTTTGTTTTGGAGACAGG - Intergenic
961957747 3:130821631-130821653 CTGGTCTAGGTCTTCTACACAGG - Intergenic
962048241 3:131784318-131784340 CTTCTCTTTGGTTCCTGCACTGG + Intronic
962529148 3:136262836-136262858 CCGCTCTTTTGTTTCTAAACAGG - Intronic
962591974 3:136899376-136899398 CTTCTCTTTCTTTTCTACTGGGG + Intronic
962773011 3:138630720-138630742 CTGTTCTTTTTTTCCTACCCTGG + Intronic
962980778 3:140487522-140487544 CTGTTCTCTGTTTTCTACTTTGG - Intronic
963015879 3:140823431-140823453 TTGCTCTTTGGTTTTTACAAGGG - Intergenic
964111342 3:153090863-153090885 ATGCTCTTTGTTTTCTATTGTGG - Intergenic
967029189 3:185590111-185590133 CAGCACTCTGTTTTCTACAGTGG + Exonic
967105582 3:186252527-186252549 CTGCCCCTTGTCTTATACACTGG + Intronic
967421007 3:189272776-189272798 CCTCTCTTTCTTTTCTACAAAGG + Intronic
968000615 3:195203570-195203592 CTGTTCTTTGTGTTTTACAGAGG - Intronic
968696868 4:2034891-2034913 CTGTTCTATGGTTTCCACACAGG + Intronic
968910284 4:3473930-3473952 CTGCCCTTTGCTTCCTACACTGG + Intronic
969031819 4:4221721-4221743 CTGCTCTCTGTTTTGGGCACTGG - Intronic
969055599 4:4400400-4400422 TTGTTCTTTGTTTTCAAGACTGG + Intronic
969172935 4:5378568-5378590 ATGCCCTTTGTCTTCTCCACTGG + Intronic
969236269 4:5867091-5867113 CTGCACTTTTTTTTCTAAACAGG + Intronic
971464619 4:26943002-26943024 CTTGTCTTTGTTTTTTACAATGG + Intronic
972402830 4:38720939-38720961 CTTCTCTTTGTGTTCTAGAACGG + Intergenic
974380220 4:61130158-61130180 CTGCTGTCTGTTGTCTTCACTGG + Intergenic
974850618 4:67401336-67401358 CTGCTTTTTTTTTTTTTCACTGG - Intergenic
977572351 4:98641867-98641889 CTGTTCTTTGTTTTATAAACTGG + Intronic
979163662 4:117497169-117497191 CTGCTTTTTATTTTGCACACAGG + Intergenic
979197933 4:117942075-117942097 CTGCTCTTCCTTTTCTGCATGGG + Intergenic
983120172 4:163873650-163873672 CTGATCTTAGTTTTCCACACTGG - Intronic
983665698 4:170179873-170179895 TTGCTCTCTGTTTCCTTCACAGG + Intergenic
983922956 4:173366944-173366966 ATGCTCTTTGCTTTCTAAAATGG - Intergenic
986399133 5:7362396-7362418 CTGAAACTTGTTTTCTACACTGG + Intergenic
986856522 5:11875018-11875040 TTCTTCTTTGTTTTCTACATGGG - Intronic
987378236 5:17257997-17258019 CTGCTCTTGCTTTTCCATACAGG + Intronic
987961254 5:24812296-24812318 CTTCTGTTTGTTTTGTTCACTGG - Intergenic
988729394 5:33955375-33955397 CTGCACTAGGTTTTCTGCACAGG - Intronic
988772893 5:34449844-34449866 CTGAGGTGTGTTTTCTACACTGG - Intergenic
989127356 5:38069497-38069519 CTGCTCTTTGGTTTCATCTCTGG - Intergenic
990182887 5:53182407-53182429 CTCCTCTTTGTTTTATATCCAGG + Intergenic
990699068 5:58456090-58456112 CTGCTGCTTGTTTTCTACTGCGG + Exonic
991286732 5:64985667-64985689 TTGCTTTTTGTTTTATATACAGG + Intronic
992040718 5:72828101-72828123 CTGCTCTTTGTCTCCTTCGCTGG - Intronic
992286863 5:75244858-75244880 CTGGTATTTTTTTTCTACAGTGG - Intergenic
992327082 5:75670624-75670646 CTGCACTTTTTTTTCTAAATGGG + Intronic
993040964 5:82814306-82814328 CAGGTCTTTATTTTCTCCACAGG + Intergenic
993448254 5:88041560-88041582 CTGCATATTGTTTTCTACAATGG - Intergenic
993483685 5:88455349-88455371 TTTCTCTTAGTTTTCTTCACAGG - Intergenic
993696112 5:91063752-91063774 GTGCACTTTGTTTTCTAAACAGG + Intronic
994949859 5:106447688-106447710 CTACTCTTTGTTATTTACCCAGG + Intergenic
995773227 5:115695611-115695633 CTGCACTTTTTTTTCTAAACAGG + Intergenic
996647617 5:125835396-125835418 CTGCACTTTGTGTTCTACTCTGG - Intergenic
996771806 5:127094284-127094306 AGGCCCTTTGTGTTCTACACTGG + Intergenic
996860845 5:128063959-128063981 CTGATCTTTTTTTTTTAGACCGG - Intergenic
996912673 5:128673243-128673265 ATGCTCATTGTTTTCTACTGAGG - Intronic
997768640 5:136531035-136531057 CTGCTCTTAGTTTTCAAAAGAGG + Intergenic
998141076 5:139699886-139699908 CTGCTGTTTGTCATCTACACAGG + Intergenic
998670604 5:144349028-144349050 CTGCTCTTTCTTGTCCACATCGG + Intronic
1001146038 5:169185542-169185564 ATGGTTTTTGTTTTCTCCACTGG + Intronic
1001606219 5:172961701-172961723 CTGCTCTGTGTTCTCTACGTAGG + Intronic
1001642054 5:173251470-173251492 CAGCCCTTTGTTCTCTACGCTGG - Intergenic
1002361621 5:178676170-178676192 CTGTTCTTTGTTTTCTGGACAGG + Intergenic
1002573880 5:180160699-180160721 CTGCTTGCTGTTTTCTCCACTGG - Intronic
1003581111 6:7341762-7341784 CTGCTCTGTCTTCTCTGCACTGG - Intronic
1008253759 6:49272733-49272755 ATGGTTTTTGTTTTCTACTCTGG + Intergenic
1011427530 6:87246847-87246869 CTGCTTTTTGTTTTTGAGACAGG - Intronic
1011895622 6:92221198-92221220 CTACTCTGTGCTTACTACACAGG + Intergenic
1013697627 6:112722675-112722697 CTGCCCTTTATTGTCAACACAGG + Intergenic
1013949063 6:115757377-115757399 TTGCTTTTTGTTTTTTAGACAGG - Intergenic
1014358773 6:120447615-120447637 CTTCTCTTAGTATTCTAAACGGG + Intergenic
1014783435 6:125590870-125590892 CTGCACTTTTTTTTCTAAACCGG + Intergenic
1017113561 6:150954927-150954949 GTTCTCTTTATTTTCTTCACTGG - Intronic
1017467643 6:154709355-154709377 CTGCACTTTTTTCTCTAAACGGG - Intergenic
1020675015 7:11172670-11172692 CTGCTATTTGTTCCCTAGACTGG - Intergenic
1022022373 7:26413343-26413365 CTGGTGTTTGTCTTCTACACAGG + Intergenic
1022308112 7:29169673-29169695 CTGCTCTGTCTTTTCTTCTCAGG + Intronic
1024354420 7:48399859-48399881 CTGCTGTTTCTTTCCTTCACTGG - Intronic
1024593924 7:50916568-50916590 CTGCACTTTGTATTTTACAAGGG - Intergenic
1026419989 7:70225041-70225063 CTGTGCTTAGTCTTCTACACAGG + Intronic
1028232506 7:88322516-88322538 ATGCTCTTTCTTTTCTGAACTGG + Intergenic
1028656689 7:93216886-93216908 GTGCTCATATTTTTCTACACTGG + Intronic
1030487558 7:110189474-110189496 TTTCTTTTTGTTTTCTTCACTGG - Intergenic
1030984462 7:116224753-116224775 CTGCTCATTGTTTGCTAGGCAGG - Intronic
1031137927 7:117905924-117905946 CTGTCCTTTGCTTTGTACACTGG + Intergenic
1031969213 7:128051953-128051975 CTGGTCTTAGTTTTGTACTCTGG - Intronic
1033579868 7:142722937-142722959 CTGCACTTTTTTTACTAAACAGG + Intergenic
1033611592 7:142968506-142968528 CTTTTCTTTCTTTTATACACAGG + Intergenic
1033996757 7:147359625-147359647 GTGCTCTTTGTTTAGCACACTGG + Intronic
1034381780 7:150702206-150702228 CTGCTCTTTGTTTCCCTCAGGGG - Intergenic
1034439202 7:151077899-151077921 CTGCACTTTGTTTTTTCCCCTGG - Exonic
1036676976 8:10842166-10842188 CTTTTTTTTTTTTTCTACACAGG + Intergenic
1039382684 8:37100626-37100648 CTTTTCTTTTTTTACTACACTGG - Intergenic
1040052034 8:43024862-43024884 CTGCCCCTTGTTTTCTAGAAAGG - Exonic
1040348439 8:46535663-46535685 CTTCTTTTTGTTTTCATCACAGG - Intergenic
1040799810 8:51328095-51328117 CTGCTATTTGTGTTCTATTCAGG - Intronic
1041256241 8:55981830-55981852 CTGCACTTTGTTTTTCCCACAGG - Intronic
1042213314 8:66403356-66403378 TTGCTCTTCTTTTTCTACATGGG + Intergenic
1042336869 8:67639066-67639088 CTGCTCTTTGTTGTTTCTACTGG - Intronic
1042883784 8:73524624-73524646 CTTGCCTTTGTTTTCCACACAGG + Intronic
1043185031 8:77137818-77137840 CTGCTCTTTGCCTTGTAAACTGG + Intergenic
1043710837 8:83416485-83416507 TTGGTCTTTTTTTTTTACACTGG + Intergenic
1043877596 8:85503656-85503678 CTGAAGTTTATTTTCTACACAGG + Intergenic
1044261204 8:90124653-90124675 CTGAAATGTGTTTTCTACACTGG - Intergenic
1045144158 8:99320672-99320694 CTGCTCTGTGTTTTATAGAATGG + Intronic
1045168876 8:99641073-99641095 TTGCTCTTTGTTCTATACATGGG + Intronic
1046129610 8:109950686-109950708 CTGCATTTTTTTTTCTAAACAGG - Intergenic
1047081911 8:121471900-121471922 CTGATATTTTTTTTCTTCACAGG + Intergenic
1048344537 8:133566784-133566806 CCACTCTCTGTTTTATACACGGG + Intronic
1049088347 8:140494950-140494972 CTGCTTTTCTTTTTCTATACTGG + Intergenic
1049949063 9:626905-626927 CTGCTATTGGTGTTTTACACTGG + Intronic
1049992949 9:1007089-1007111 CTGTTCTTTGTTTCCTCAACTGG - Intergenic
1050093014 9:2034405-2034427 GTCCTCTTTCTTTTCTTCACTGG + Intronic
1051957240 9:22711299-22711321 CAGCTCTGTGTTTTATACCCTGG - Intergenic
1056487482 9:87073332-87073354 CTGCTCCCTGCTTTCTGCACAGG + Intergenic
1056521235 9:87403388-87403410 CTGCTCTTTGGTTTCTCCTTTGG - Intergenic
1056796425 9:89662014-89662036 CTGCCCTTTGCATTCAACACAGG + Intergenic
1057862903 9:98656141-98656163 CAGCTCTTTGGTGACTACACTGG - Intronic
1058479984 9:105382173-105382195 CTACTCTTTTTTTTCTACTCAGG + Intronic
1059038374 9:110785276-110785298 CTGCTCCTTGTCTTCTCCTCAGG + Intronic
1060040070 9:120292575-120292597 CTGCTCTTTTTTTTTGAAACAGG - Intergenic
1060716544 9:125935552-125935574 CTCCTCTTTGGCTTCTTCACTGG - Exonic
1061658479 9:132111271-132111293 TTGCTCTTTGTTTTCTACATTGG + Intergenic
1185547680 X:958598-958620 CAGCTCTCTGTTTTCTTCAAAGG + Intergenic
1186332459 X:8549509-8549531 CTGCTCTTTGTTGTTCACAAAGG + Intronic
1187726383 X:22207157-22207179 CTGCTTTTGGTTTTCTACTGGGG - Intronic
1187801695 X:23070752-23070774 CTGCACTTTTTTTTCTAAATGGG - Intergenic
1188509153 X:30915406-30915428 CTGATCTTTCTATTCTACAATGG + Intronic
1189393675 X:40601294-40601316 CTTCTTTTTGTTTTCAAAACAGG - Intronic
1190007039 X:46750110-46750132 CTTTGCTTTGTTTTCTACTCTGG + Intronic
1190022247 X:46889959-46889981 CTTTGCTTTGTTTTCTACTCTGG - Intronic
1192571899 X:72213037-72213059 ATGCTCTTTGTTTTGTAATCTGG + Intronic
1196384691 X:115136672-115136694 CTGCTCTTTGTTTTCTACACAGG - Intronic
1199043045 X:143137629-143137651 TAGCTCTTTGTTTACTACATGGG - Intergenic
1199233091 X:145461990-145462012 CCCCTCTTTGTTTTCTACTGAGG - Intergenic
1200320124 X:155179552-155179574 CTGCACATTGGTTTCTTCACTGG + Intergenic
1201553796 Y:15247353-15247375 CTGACCTTTGTTTTCTATTCAGG + Intergenic
1201982726 Y:19924687-19924709 CTGATCTTTGTTTCCTTCTCTGG + Intergenic