ID: 1196384963

View in Genome Browser
Species Human (GRCh38)
Location X:115139690-115139712
Sequence AGGGAGAGCACAGGGACTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 952
Summary {0: 1, 1: 19, 2: 44, 3: 144, 4: 744}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196384946_1196384963 25 Left 1196384946 X:115139642-115139664 CCCACAGTAGCCAGCAGTGCAGG 0: 1
1: 0
2: 2
3: 22
4: 208
Right 1196384963 X:115139690-115139712 AGGGAGAGCACAGGGACTGGGGG 0: 1
1: 19
2: 44
3: 144
4: 744
1196384957_1196384963 -7 Left 1196384957 X:115139674-115139696 CCTGTATACTTGGGGGAGGGAGA 0: 1
1: 0
2: 6
3: 15
4: 150
Right 1196384963 X:115139690-115139712 AGGGAGAGCACAGGGACTGGGGG 0: 1
1: 19
2: 44
3: 144
4: 744
1196384948_1196384963 24 Left 1196384948 X:115139643-115139665 CCACAGTAGCCAGCAGTGCAGGG 0: 1
1: 0
2: 5
3: 33
4: 571
Right 1196384963 X:115139690-115139712 AGGGAGAGCACAGGGACTGGGGG 0: 1
1: 19
2: 44
3: 144
4: 744
1196384950_1196384963 15 Left 1196384950 X:115139652-115139674 CCAGCAGTGCAGGGAGAGAAAGC 0: 1
1: 0
2: 2
3: 32
4: 295
Right 1196384963 X:115139690-115139712 AGGGAGAGCACAGGGACTGGGGG 0: 1
1: 19
2: 44
3: 144
4: 744

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196384963 Original CRISPR AGGGAGAGCACAGGGACTGG GGG Intronic
900103928 1:974213-974235 AGGGAGAGCAGGGGGACATGGGG + Intronic
900496576 1:2978596-2978618 AAGGAGGGCACACGGACAGGAGG + Intergenic
900767103 1:4513015-4513037 AGAGGGAGGACAGGGAATGGAGG + Intergenic
900831217 1:4967111-4967133 GGGGAGAGCAGTGGGAATGGAGG - Intergenic
901143159 1:7048641-7048663 AGGGAAGGCTCAGGGACAGGTGG - Intronic
901769703 1:11524053-11524075 AGGGTGAGCACTGGGGGTGGAGG + Exonic
902073830 1:13766526-13766548 ATGGAGGGCAGAGGAACTGGAGG + Intronic
902383657 1:16064465-16064487 AGGGAGAGCAGAGCCTCTGGGGG - Intronic
902478604 1:16700470-16700492 TCGGAGAGCACAGGCTCTGGAGG - Intergenic
902600490 1:17537559-17537581 AGGGAGAGGTCAGGGAATGGAGG + Intergenic
902808155 1:18873501-18873523 AGGGAGGGCAGAGGGGCTGGAGG + Intronic
903063641 1:20686293-20686315 AGGGAGAGAACAGGGAAGAGAGG + Intronic
903316883 1:22515042-22515064 AGTGAGAGGACAGGGCTTGGGGG + Intronic
903377375 1:22875439-22875461 TGGGTGGGCACAGGGCCTGGGGG + Intronic
903499206 1:23792368-23792390 AGGCAGGGCATAGGGACTGTAGG - Intronic
904040477 1:27581568-27581590 AGAGAGACCACTTGGACTGGAGG - Intronic
904108648 1:28107409-28107431 AGGTAGAGAACAGGGCCTGTAGG + Intergenic
904128815 1:28260498-28260520 AGGGAGAGCGCAGGGGCTCTGGG + Intronic
904277735 1:29395145-29395167 TGGGAGAGGACAAGGACAGGCGG + Intergenic
904416849 1:30367417-30367439 AAGCAGAGGAAAGGGACTGGTGG - Intergenic
904490820 1:30858051-30858073 AGGGAGGGGACAGGGGCAGGGGG - Intergenic
905262807 1:36731352-36731374 AGGGTGGGCACAGGACCTGGAGG - Intergenic
905353378 1:37363117-37363139 AGCGGGAACACAGAGACTGGCGG - Intergenic
905507305 1:38490130-38490152 AGGGAGATCAGAGTGACTAGAGG + Intergenic
905622045 1:39456794-39456816 AGCCAGACCACAGGGACTTGGGG - Intronic
905739816 1:40360692-40360714 AAGGAGAGCACAGTGATTGTGGG + Intronic
906581827 1:46941268-46941290 AGGGAGGGCACGGGAACTGCTGG + Exonic
906601890 1:47137629-47137651 AGGGAGGGCACGGGAACTGCTGG - Exonic
906678120 1:47708071-47708093 AGGGGGAGCTCAGTGACTCGCGG - Intergenic
906935213 1:50208665-50208687 AGGGAGAGCACAGGAATAAGAGG + Intergenic
907255182 1:53173547-53173569 GGGGAGAGGACAGGGAGGGGAGG - Intergenic
907644117 1:56224464-56224486 TGAGAGAGCCCAGGGAGTGGAGG - Intergenic
907775142 1:57506895-57506917 ATGGAGAGGAGAGGGAATGGTGG - Intronic
907827876 1:58036335-58036357 AGGGAGAGCCCAGGGCCCGTGGG + Intronic
909356605 1:74716810-74716832 AATGAGAGCACAGGGGCTGCGGG - Intronic
909583164 1:77260783-77260805 AGCGAGGGGGCAGGGACTGGGGG - Intergenic
909848910 1:80434818-80434840 AGGGAGATCTCAGTGACTGGGGG - Intergenic
910139320 1:84009271-84009293 AGGGAGAGGAATGGGGCTGGTGG - Intergenic
910422437 1:87080768-87080790 GGGGAGAGCACAGTGATTGCGGG + Intronic
910470525 1:87547745-87547767 AGGGAGAGGACAGTGACTGTGGG - Intergenic
910801255 1:91149060-91149082 AGGGGGAGCACAGTGATTGTGGG - Intergenic
912601013 1:110933545-110933567 AGGGAGAGCACAGCAATTGCGGG + Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912871407 1:113310480-113310502 AGGGAGAGCACAGGGATTGTGGG + Intergenic
912899303 1:113630726-113630748 AGGGGGAGCACAGTGGCTGATGG - Intronic
913150562 1:116038387-116038409 AGGGAGAACACATGGCCTTGGGG - Intronic
913314324 1:117537305-117537327 AGAGAGAGCCAAGGGACTCGGGG + Intergenic
913498596 1:119450268-119450290 GGGGATAGGACAGGGATTGGTGG - Intergenic
915168553 1:153962463-153962485 AGGGAGGGCTCTGGGGCTGGCGG - Intronic
915310749 1:155004818-155004840 AGGGAGGGGACAGTGTCTGGGGG - Intronic
915482241 1:156194760-156194782 AGGGAGAACAGAAGGAATGGAGG + Intronic
915611422 1:156996441-156996463 AGGGAGGACACAGGGACTCTGGG + Intronic
915724468 1:158007803-158007825 AGCGAGGGCACAGGGGCTGCTGG - Intronic
916464713 1:165062396-165062418 AGGGAGATCACGGGGAAAGGGGG + Intergenic
916498423 1:165365860-165365882 GGGCAGAGAGCAGGGACTGGAGG - Intergenic
917191251 1:172421847-172421869 AGGGAGGGCACAGCGATTGTGGG + Intronic
917300675 1:173570832-173570854 AGGGAGACCACAGCAACTGGGGG - Intronic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917373210 1:174317941-174317963 AGGGAGAACACAGCAACTGTGGG - Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
917405039 1:174696678-174696700 AGGGAGAGAGCAGGGATTGTGGG - Intronic
917500149 1:175578369-175578391 AGGGAGAGGAAAGGCACTGGAGG + Intronic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
918399285 1:184147383-184147405 TGGGTGAGCACAGGGCCAGGTGG + Intergenic
919012934 1:191988480-191988502 AGGGAGAACACAGCAACTGGGGG + Intergenic
919147336 1:193651935-193651957 AGGGAGAGCACAGTAACTGTGGG - Intergenic
919257592 1:195143401-195143423 GGGGAGAGCACAGGGACCGGAGG - Intergenic
919767779 1:201138489-201138511 AGGGAGAGGGGAGGAACTGGTGG - Intronic
920187100 1:204166498-204166520 ATGGGGAGCAGAGGGGCTGGAGG + Intergenic
920596827 1:207280192-207280214 AGGGAGAGCACAGTTACTGTGGG - Intergenic
920691099 1:208146817-208146839 AGGGAGGTGACAGGGACAGGTGG + Intronic
920852886 1:209640600-209640622 AGGGAATGCACAGTGAGTGGTGG - Intronic
921053477 1:211527134-211527156 GGGGAGAGAGCAGGGCCTGGGGG + Intergenic
922022715 1:221720307-221720329 AGGGAGGAGACAGGGACTGAAGG + Intronic
922139286 1:222866131-222866153 AGGGTGAGCAGAGGAACTGTTGG + Intergenic
922237008 1:223729610-223729632 GGGGAAGGCACAGGGGCTGGAGG + Intronic
922388659 1:225114776-225114798 AGAGAGAGCACAGTGACTGTGGG - Intronic
922762993 1:228143904-228143926 ATGGAGAGCACATGGACTTCTGG + Intronic
922806195 1:228391319-228391341 AGGGAAAGCACAGGGATCCGGGG + Intergenic
923069487 1:230549542-230549564 ATGGAGTGCACAGAGCCTGGCGG + Intergenic
923110378 1:230885296-230885318 AGGGAGAGAACATAGCCTGGAGG - Intergenic
923918051 1:238530566-238530588 AGGGAGAGGCCAGGGAGTGAGGG + Intergenic
924516319 1:244769011-244769033 AGGGAGAGCGCAGTGACTGGGGG - Intergenic
924633930 1:245767137-245767159 GGGGAGAGAAGAGGGCCTGGAGG + Intronic
1062831604 10:609209-609231 AAGGAGAGCAGAGGTATTGGTGG - Intronic
1062913791 10:1231793-1231815 AGGGAAAGCAGTGGGGCTGGAGG + Intronic
1063866148 10:10367391-10367413 AGCCAGAGCAGCGGGACTGGAGG - Intergenic
1064231131 10:13529556-13529578 AAGGAGAGCACTTGGAATGGGGG + Intergenic
1064261370 10:13788928-13788950 AGGGAGAGCAGGGAGAATGGAGG - Intronic
1064598819 10:16972837-16972859 ATGGAGAGCGCAGGGACACGTGG - Intronic
1065495042 10:26318977-26318999 AGGGCGAGCACAGGACCTGCAGG + Intergenic
1066622645 10:37374576-37374598 AGAAACAGCACAGGGACTGTGGG + Intronic
1066708133 10:38203221-38203243 AGGGAGAGCACAGCAACTGTGGG + Intergenic
1066981375 10:42419362-42419384 ATGGAGAGCACAGCAACTGTGGG - Intergenic
1067299189 10:44993687-44993709 AGGAAGAGGACAGGGGCTTGTGG - Exonic
1067324464 10:45253729-45253751 GAGGAGAGCACAGTGATTGGAGG + Intergenic
1067951140 10:50739492-50739514 AGGGAGATCTCAGGTTCTGGGGG - Intronic
1068124901 10:52827524-52827546 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
1068556038 10:58460089-58460111 AAGGAGAGCACAGAGACAGAAGG - Intergenic
1069050571 10:63788305-63788327 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1069185543 10:65418014-65418036 AGGCAGAGCAAAGGGGTTGGGGG - Intergenic
1069599495 10:69694203-69694225 AGAGAGGCTACAGGGACTGGTGG + Intergenic
1069729679 10:70602620-70602642 AAGGAGAGAGCAGGGATTGGGGG - Intronic
1070059556 10:72968675-72968697 AGGGAAAGTACAGTAACTGGGGG - Intergenic
1070083454 10:73211230-73211252 AGGGAGAAGACAGGGGCTGAAGG - Intronic
1070804241 10:79261382-79261404 AGGGAGAGAGCAGGCGCTGGAGG + Intronic
1071770661 10:88726142-88726164 AGGGAAACCACAGGGAATTGTGG - Intronic
1071893370 10:90037462-90037484 AGGGGCAGCATAGGGACTAGCGG + Intergenic
1071913055 10:90257570-90257592 AGGGAGGGCTTAAGGACTGGGGG + Intergenic
1072265160 10:93720202-93720224 AGGCAGAGCACAGACTCTGGGGG + Intergenic
1072710416 10:97712824-97712846 AAGGAGAGAAGAGAGACTGGTGG + Intergenic
1073196289 10:101694679-101694701 GGGAAGAGCACAGGGACGAGGGG - Exonic
1073212792 10:101818384-101818406 AGGGAGAGCTCGGGGCTTGGAGG - Exonic
1073232406 10:101983225-101983247 AGGGAGAGAAGAGGGGCTGAAGG + Intronic
1073285341 10:102384068-102384090 AGGGAGGGAAGAGGGACTGAAGG + Intergenic
1073827212 10:107337478-107337500 AGGGAGATCACAGTGACTGGGGG - Intergenic
1073863777 10:107777301-107777323 AAGAAGAGCACATGGCCTGGTGG - Intergenic
1074028971 10:109665173-109665195 AGGGAGTGAACAGGGAGTGAAGG - Intergenic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1075065608 10:119287192-119287214 AGGGAGAGAACAGGGAGAGAGGG + Intronic
1075302385 10:121336658-121336680 AGGGAGACAATAGGGAGTGGTGG + Intergenic
1075536317 10:123275035-123275057 AGGGAGGGGGCAGGGGCTGGCGG + Intergenic
1075903307 10:126060802-126060824 CAGGAGTGCACAGGGACTGTGGG + Intronic
1076044609 10:127281651-127281673 AGGGAGACCCCAGGGGCTTGTGG + Intronic
1076067905 10:127463739-127463761 AGGGAGGGCACAGGGACAGCAGG - Intergenic
1076082911 10:127599745-127599767 AGCCTGGGCACAGGGACTGGTGG + Intergenic
1076261733 10:129071842-129071864 AGTGGGAGCACAGGCACAGGAGG + Intergenic
1076749516 10:132535599-132535621 AGGGAGGGCACAAGGGGTGGGGG + Intergenic
1076768415 10:132650268-132650290 AGGCAGAGGGCAGGGAATGGCGG - Intronic
1076846333 10:133071257-133071279 GGAGAGAGCACAGGAGCTGGGGG + Intronic
1076864127 10:133159119-133159141 AGAGAGAGCTCAGGGACAGCTGG + Intergenic
1076875953 10:133215617-133215639 AGGATGAGCACAAGGACAGGTGG + Intronic
1076913352 10:133403409-133403431 CGAAGGAGCACAGGGACTGGGGG - Intronic
1077225759 11:1438466-1438488 TTGGGGAGCACAGGGGCTGGAGG + Intronic
1077391460 11:2302422-2302444 AGGGGCAGCACAGAGCCTGGAGG + Intronic
1077533397 11:3107740-3107762 GGCGAGGGCACAGGGGCTGGTGG - Intronic
1078690783 11:13578735-13578757 AGGGAGAGTGCAGGGATTGCGGG + Intergenic
1079416299 11:20239182-20239204 AAGGAGAGCACAGTGACTGGGGG - Intergenic
1079532894 11:21476796-21476818 AGGGAGAGCACAATGATTGTGGG + Intronic
1079892876 11:26079946-26079968 AGGGAGAGGAGAGGGAGAGGGGG + Intergenic
1080707252 11:34707941-34707963 AGGGCAAGCACAGTGACTAGGGG - Intergenic
1080723926 11:34875744-34875766 AGGGCGAGCACACGGATGGGCGG - Intronic
1081245653 11:40763653-40763675 AGGGAAAGCACAGTGATTGTGGG + Intronic
1081578271 11:44333322-44333344 AGTGAGAGCACATGGACACGGGG - Intergenic
1081587597 11:44398121-44398143 AGGGCGGGCACAGGGACTTGCGG - Intergenic
1081685688 11:45041636-45041658 AGGGACAGCAAAGGCAATGGAGG - Intergenic
1083169329 11:60913587-60913609 AGGCAGTGCATAGGGACAGGAGG - Intergenic
1083464696 11:62837593-62837615 TGGGAGAGGCCAAGGACTGGAGG - Intronic
1083477445 11:62923359-62923381 AGGGAGACCAAGGAGACTGGGGG - Intergenic
1083538973 11:63498464-63498486 AGGGAGAGCATGGTGACTGAAGG - Intergenic
1083902676 11:65651209-65651231 AGAGAGAGGACAAGGCCTGGGGG - Intergenic
1084071626 11:66740250-66740272 AGGAAGAAAACAGGGAATGGGGG + Intergenic
1084079335 11:66810315-66810337 AGGAAGAGCACTGGAAGTGGTGG + Intronic
1084308034 11:68299260-68299282 AGGGACAGCTTGGGGACTGGAGG + Intergenic
1084660797 11:70545185-70545207 AGCGCGAGCCCAGGGACTGCAGG - Intronic
1084664820 11:70570680-70570702 AGGGAGTGCCAAGGGGCTGGAGG + Intronic
1084859894 11:72011447-72011469 AGGAAGAGCACAGGGAGTAGGGG + Intronic
1084948417 11:72651475-72651497 AGGGAGAGGCCAGGGTCTGGGGG + Intronic
1084959747 11:72710182-72710204 AGGGCCAGGGCAGGGACTGGAGG + Intronic
1085026245 11:73238229-73238251 AGGGACAGGACAGGGATGGGAGG + Intergenic
1085036015 11:73300542-73300564 GAGGAGGGCACAAGGACTGGAGG - Intergenic
1085052108 11:73385176-73385198 TGGGAGAGCTTAGGGACTGTAGG + Intronic
1085459427 11:76684592-76684614 AGGGAGAGCACAGCAACAAGGGG - Intergenic
1085727525 11:78967165-78967187 AGGGAGAGTCCAGGGAGTTGTGG - Intronic
1085780107 11:79400522-79400544 AGGAAGAGCACAGGGAGGAGAGG - Intronic
1086032990 11:82383213-82383235 AGGGAGAGCACAGCAACTGAGGG + Intergenic
1086069297 11:82782188-82782210 AGGCAGAGAATAGGGTCTGGAGG + Intergenic
1086124440 11:83335623-83335645 AGGGAGAGCCCTTGGACAGGAGG - Intergenic
1086249837 11:84799327-84799349 AGGAAGAGCACAGCAGCTGGAGG - Intronic
1086847921 11:91774415-91774437 AGGGAGAGCACAGCGATTTTAGG - Intergenic
1087370595 11:97279249-97279271 AGGGACAGTGCAGGGATTGGAGG + Intergenic
1087600473 11:100308447-100308469 AGGAAGACCACAGGGATTTGAGG + Exonic
1087746756 11:101956477-101956499 AGGGAGAGAACTGAGGCTGGTGG - Intronic
1088248728 11:107844162-107844184 AGTAAGAGCACAGGCTCTGGGGG + Intronic
1088330638 11:108647591-108647613 AGGGAGAGCAAAGTGAGTGTGGG + Intergenic
1088397589 11:109385577-109385599 AGGCAGAGCACAGGGAATTTAGG - Intergenic
1088569814 11:111212528-111212550 AGGGAGAGCACAGCAATTGTGGG + Intergenic
1088742590 11:112779200-112779222 AGGAAGAGCTCAGGGTCTGAAGG - Intergenic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1089460942 11:118653161-118653183 TGGGAGAGAACAGGAGCTGGAGG + Intronic
1090439474 11:126713877-126713899 AGGGGGAGCACAGTGCTTGGAGG + Intronic
1091171804 11:133526275-133526297 AGGGAGAGCACCAAGGCTGGGGG + Intronic
1091187624 11:133660375-133660397 AGGGAAACTACAGGGACAGGTGG + Intergenic
1091239664 11:134043986-134044008 AGTGGGAGCAGATGGACTGGAGG - Intergenic
1091347428 11:134864613-134864635 GGAGGGAGCACAGGAACTGGGGG + Intergenic
1091647584 12:2285436-2285458 AGGGAGAGCCCAGGTAGTGGAGG + Intronic
1092477141 12:8828950-8828972 CGGGAGAGCACAGTGACTGTGGG - Intronic
1092943948 12:13436035-13436057 AGGAAGGGCAGAGGGAGTGGGGG - Intergenic
1092979392 12:13778465-13778487 AGGGAGGGGACAGGGTCTTGTGG + Intronic
1093581730 12:20791194-20791216 AGGGAAAGAACAGCAACTGGGGG - Intergenic
1093654067 12:21674944-21674966 AGGGAGGGGACAGGGGCTGAAGG + Intronic
1093696001 12:22161143-22161165 AGGGAGATAACAGGGAGTGTTGG + Intronic
1093699031 12:22196915-22196937 TGGGAGAGGACAGAGACTGACGG + Exonic
1093746642 12:22749827-22749849 AGGCAGAGCTCAGGGACTAATGG + Intergenic
1093931626 12:24960329-24960351 AGGAAGAGCACAGTGACTGTGGG + Intergenic
1094419680 12:30257476-30257498 AGGGAGAGCACAGTAACTATAGG + Intergenic
1094599753 12:31898189-31898211 AGGGAGAGGAAGGGGAGTGGGGG + Intergenic
1095101014 12:38183924-38183946 AGAGAGAGCACAGTGACTGGAGG + Intergenic
1095181823 12:39154805-39154827 AGGGAGAGCACAGCAATTGTGGG - Intergenic
1095803838 12:46296716-46296738 AGGAAAAGCAGAAGGACTGGAGG - Intergenic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1095909813 12:47414742-47414764 AGGGACAGGTCAGGGACTAGTGG - Intergenic
1096975856 12:55698985-55699007 AGGGAGGGGGCAGGGGCTGGGGG - Intronic
1097179503 12:57163128-57163150 GGGGAGAGCAAAGGCTCTGGGGG + Intronic
1097187326 12:57202819-57202841 AGGCACAGCACAGGGATGGGGGG - Intronic
1097981351 12:65741032-65741054 AGGGAGAGGACTGGGAATGTTGG - Intergenic
1098395201 12:70010213-70010235 AGGGACAGCACAGCAACTGTAGG + Intergenic
1098977030 12:76913396-76913418 GGGGAGGGGAGAGGGACTGGAGG + Intergenic
1099101011 12:78440094-78440116 AGGGAGAGCAAAGTGACTGTGGG - Intergenic
1099610208 12:84858035-84858057 AGGGAAAGCACAGTGACTAAGGG - Intergenic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1099807831 12:87542812-87542834 AGGCAGAGCACAGCGACTGTAGG + Intergenic
1101252100 12:102946556-102946578 AGGGACAGCAAAGGGATTGTGGG - Intronic
1102247985 12:111367281-111367303 AGGCACAGGAGAGGGACTGGGGG - Intronic
1102258574 12:111429975-111429997 AGGCAGAGCTCAGGTCCTGGCGG + Intronic
1102497421 12:113329361-113329383 AGTGAGAGGACAGGAAATGGAGG - Intronic
1102543430 12:113638304-113638326 AGGGAAGCAACAGGGACTGGAGG + Intergenic
1103171405 12:118823266-118823288 AGTGTGAGCACAGGGACTGATGG + Intergenic
1103415581 12:120740003-120740025 AGGGCGAGGACACAGACTGGGGG - Exonic
1103522455 12:121545611-121545633 AGGGAGAGCGGAGGGGCTGAGGG - Intronic
1103588869 12:121976373-121976395 AGGAAGAGCTCAGTGAATGGAGG + Intronic
1104230678 12:126880991-126881013 AGGGAAAGACCAGGGATTGGTGG - Intergenic
1104477160 12:129080322-129080344 AGAGAGACAACAGGGAGTGGTGG - Intronic
1104516830 12:129434961-129434983 AGGGAGGGTACTGGGGCTGGGGG - Intronic
1104991298 12:132625234-132625256 AGGGAGTGAGCAGGGCCTGGAGG - Intronic
1105503596 13:20992023-20992045 GGGAAGAACACAGGGACTGGTGG + Intronic
1106350213 13:28922631-28922653 AGGGAGAGCGCAATGACTGGGGG - Intronic
1106379528 13:29223139-29223161 AGGGATAGCCCAAGGCCTGGGGG + Intronic
1107210756 13:37851829-37851851 AGGGAGAGCACAGCAACAGGTGG + Intronic
1109554629 13:63955819-63955841 AGGGAGAGCAAAGGGAGTATGGG - Intergenic
1109961760 13:69640024-69640046 AGGGAGAGCACAATGATTGCGGG - Intergenic
1111639193 13:90946625-90946647 AGGGAGAGCATAGTGATTGTGGG + Intergenic
1111933211 13:94532875-94532897 AGAGAGAGGAAAGGGAATGGGGG - Intergenic
1112944499 13:104910748-104910770 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1113244428 13:108378253-108378275 AGGGATAGCACAGTGACTGTGGG - Intergenic
1113602830 13:111582862-111582884 AGGGAAAGCACAGCAGCTGGGGG - Intergenic
1113827449 13:113267844-113267866 ATCGAGGGCACAGGGAGTGGGGG + Intergenic
1114430859 14:22659164-22659186 AGGGAGAGCAGAGATGCTGGAGG - Intergenic
1114651003 14:24284568-24284590 AGGGGAAGACCAGGGACTGGAGG + Intergenic
1114657801 14:24326347-24326369 TGGGAGAGCACAGGGGGAGGTGG + Intronic
1115133883 14:30086206-30086228 AGGGAGAGCACAGTGACTGGGGG + Intronic
1116164947 14:41323400-41323422 AGGGAGGGGACAGGGGCTGAAGG + Intergenic
1116354700 14:43914009-43914031 AGGGACAGCACAGTGATTGTGGG + Intergenic
1116869489 14:50057613-50057635 GGGGAGCACACAGGGACTTGGGG + Intergenic
1116888951 14:50249001-50249023 AGGGAGGGTACAGTGGCTGGGGG + Intronic
1117105483 14:52393949-52393971 AGGGAGGGCACAGGGGCTTCAGG - Intergenic
1117161617 14:52995341-52995363 AGGGAGAGCACAGTGACTATGGG - Intergenic
1117190788 14:53289112-53289134 AGGGAGAGGAAAGGGGCTGCAGG + Intergenic
1117208572 14:53470823-53470845 AGAGAGAGCACAGTGATTGTGGG - Intergenic
1117384369 14:55195809-55195831 AGGGAGAGCGCAGTGACTGATGG - Intergenic
1117880038 14:60304410-60304432 AAGGAGAGCACATGGGGTGGAGG - Intergenic
1118034282 14:61849623-61849645 AGGGAGAGCATAGTGATTGTGGG - Intergenic
1118431284 14:65720949-65720971 AGGGGGAGCACAGTGATTGTGGG - Intronic
1118949120 14:70418060-70418082 AGTTAGACCACAGGGATTGGTGG + Intergenic
1120439763 14:84521189-84521211 AGGGGCAGCTCAGGGACTGTGGG - Intergenic
1120697322 14:87659044-87659066 AGGGAGAGCACGGTCACTGGAGG + Intergenic
1121112215 14:91320254-91320276 AGGGAGGAGACAGGGCCTGGAGG + Intronic
1121441986 14:93955284-93955306 TGGGAGAGTGCAGGGGCTGGTGG - Intronic
1121555092 14:94830422-94830444 AAGGAGAGCAGAGAGACTGGGGG - Intergenic
1121598661 14:95186246-95186268 AGGGAAGGCAGAGGCACTGGGGG - Exonic
1122070280 14:99201559-99201581 AGGGCCAGGACAGGGACTGGGGG - Intronic
1122269491 14:100562172-100562194 ATGGAGAGCAGGGGGCCTGGGGG + Intronic
1122301069 14:100731461-100731483 AGAGAGACCACAGGGACACGTGG + Intronic
1122692472 14:103537808-103537830 AGGCAGAGAAGAGGGAGTGGAGG - Intergenic
1122925642 14:104898238-104898260 AGTGAGGGCACAGGGGCTGCGGG + Intergenic
1123037665 14:105478062-105478084 AGAGGGAGAACAGGGCCTGGGGG + Intronic
1125239587 15:37558493-37558515 AGGGAGGGCACTGGCAGTGGTGG - Intergenic
1126435913 15:48637369-48637391 AGGGAAAGGAGAGGGACTAGTGG - Intronic
1126612862 15:50547311-50547333 AGGAAGCACACAGGGACAGGAGG + Intergenic
1128068889 15:64781397-64781419 AGGGAGAGCTCAGGGATTTGGGG - Intergenic
1128148291 15:65344859-65344881 TTAGACAGCACAGGGACTGGGGG + Intronic
1128384506 15:67137993-67138015 TGGGAGGTCACAGGGACGGGAGG - Intronic
1128708255 15:69852970-69852992 AGGAAGGGCTCAAGGACTGGAGG + Intergenic
1128712085 15:69879594-69879616 AGAAGGAGCACAGGGATTGGGGG - Intergenic
1128761191 15:70217075-70217097 AAGGGAAGCACAGGGAGTGGAGG - Intergenic
1129264731 15:74387549-74387571 AGAGAGAGCACATGGACCGGCGG + Intergenic
1129721147 15:77878812-77878834 AGGGAGGGAAAAGGGACAGGAGG + Intergenic
1129803762 15:78437616-78437638 GTGGAGAACACAGGGACCGGAGG + Intronic
1130062206 15:80578175-80578197 AGGGAGAGCACAGCAGCAGGAGG + Intronic
1130441259 15:83956217-83956239 AGGGAGAGCACAGCAACTGGGGG - Intronic
1131005375 15:88973220-88973242 AGGGAAAACACAAGGTCTGGGGG - Intergenic
1131999342 15:98163484-98163506 AGGGAGGCCACAGGGGCTGAGGG - Intergenic
1132311099 15:100858567-100858589 AGTGAGAGCTCAGTGACTGAAGG - Intergenic
1132621874 16:871638-871660 CAGGAGGGCACAGGGTCTGGTGG - Intronic
1132703498 16:1231555-1231577 ATGGAGAGCACAGGGAGCTGGGG - Intergenic
1132705014 16:1239806-1239828 ATGGAGAGCACAGGGAGCTGGGG + Intergenic
1132708016 16:1254840-1254862 ATGGAGAGCACAGGGAGCTGGGG + Intergenic
1132731189 16:1362779-1362801 AGGGAAAGCCCAGGTGCTGGAGG - Intronic
1133169362 16:3971640-3971662 AGGAAGAGAATATGGACTGGGGG + Intronic
1134091433 16:11393598-11393620 GGGGAGAGACCAGGGACAGGTGG - Intronic
1135771998 16:25224716-25224738 AGGCAGACAACAGGGAGTGGTGG + Intronic
1135864653 16:26090249-26090271 AAGGAGAACACTGGGACTGCAGG - Intronic
1135972084 16:27079650-27079672 AGGGAGGCAACAGGGAGTGGTGG + Intergenic
1136146044 16:28317310-28317332 GGGGAGGGCAGAGGGGCTGGAGG + Intronic
1136389299 16:29952303-29952325 AGAGAGAGCACATGGACTGGGGG - Intronic
1136605196 16:31329201-31329223 AGGGAGAAAAAAGGGACAGGAGG - Intronic
1136676615 16:31914175-31914197 ACGGAGAGCACAGTGACTAGGGG - Intronic
1137273517 16:46918528-46918550 AGGGAGGGCACAGGTGCTGTGGG - Intronic
1137384068 16:48025321-48025343 AGGGAGAGAACAGGCAGTTGTGG - Intergenic
1137630930 16:49944213-49944235 AGGGAGAGAACAGGGCCACGTGG + Intergenic
1138194987 16:55045385-55045407 ATGGAGAGCAGAGGGCCTGGAGG - Intergenic
1138418928 16:56886797-56886819 AGGGAAAACACAAGGAGTGGGGG - Intronic
1138806933 16:60100906-60100928 AGAGCGAGCACAGTGACTGTGGG - Intergenic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1141429132 16:83961861-83961883 AGGGAGACCACAAGGACTGGGGG - Intronic
1142029427 16:87831182-87831204 AGGGACAGCCCACGGTCTGGAGG - Exonic
1142067569 16:88071571-88071593 AGGGAGAGCAAAGGAGCTGCTGG - Intronic
1142119795 16:88381628-88381650 AGGGAGATCCCAGGACCTGGAGG + Intergenic
1142497695 17:315180-315202 AGGTGGAGCACAGGGACTACAGG - Intronic
1142497789 17:315579-315601 AGGTGGAGCACAGGGACTACAGG - Intronic
1142497800 17:315639-315661 AGGTGGAGCACAGGGACTACAGG - Intronic
1142497911 17:316129-316151 AGGTGGAGCACAGGGACTGCAGG - Intronic
1142497917 17:316159-316181 AGGTGGAGCACAGGGACTACAGG - Intronic
1142497947 17:316311-316333 AGGTGGAGCACAGGGACTACAGG - Intronic
1142498007 17:316644-316666 AGGTGGAGCACAGGCACTGCAGG - Intronic
1142498012 17:316674-316696 AGGTGGGGCACAGGGACTGCAGG - Intronic
1142498062 17:316887-316909 AGGTGGAGCACAGGGACTACAGG - Intronic
1142498112 17:317160-317182 AGGTGGAGCACAGGGACTAAAGG - Intronic
1142498124 17:317220-317242 AGGTGGAGCACAGGCACTGCAGG - Intronic
1142498129 17:317250-317272 AGGTGGGGCACAGGGACTGCAGG - Intronic
1143030747 17:3965604-3965626 AGGAAGAGCACAGAATCTGGGGG - Intergenic
1143443724 17:6995529-6995551 CGGCAGAGCTCAGGTACTGGAGG + Intronic
1144312379 17:14024996-14025018 AGAGAGAGCACTGGAGCTGGAGG + Intergenic
1144332373 17:14236329-14236351 AGAGAGAGCACTGGAGCTGGAGG - Exonic
1144702690 17:17349276-17349298 AGGGAGAGCCCCGGGCCTGGGGG + Intergenic
1144858478 17:18284388-18284410 AGGAAGAGCAGAGGGGCTGGAGG - Intronic
1144860159 17:18296684-18296706 AAGAAGCACACAGGGACTGGTGG - Intronic
1145067807 17:19773936-19773958 AAGGAGGGGACAGGGACTGTGGG + Exonic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1145392362 17:22465476-22465498 GGGGAGAGGAGAGGGACTGAAGG + Intergenic
1145879251 17:28341819-28341841 ATGGAGAGGACATGGCCTGGAGG - Intronic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1147140078 17:38455754-38455776 AGGGAGCGAAAAGGGTCTGGGGG - Intronic
1147322764 17:39656253-39656275 AGGGAGGACACAGGGACTCTGGG - Intronic
1147661233 17:42118146-42118168 AGAGAGAAGGCAGGGACTGGGGG + Intronic
1147868778 17:43572446-43572468 AGGGAGAAAAGTGGGACTGGAGG + Intronic
1147907812 17:43833967-43833989 GGGGAGAGCATAGGAACTGCTGG + Intergenic
1148080676 17:44966482-44966504 AGTGAGAGCACTGGGAAGGGAGG + Intronic
1148530625 17:48387329-48387351 AGAGAGTGCACAGGGATAGGAGG - Intronic
1149188436 17:54029953-54029975 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1149570141 17:57666497-57666519 AGGGACAAAACAGGGCCTGGAGG - Intronic
1149626418 17:58083612-58083634 AGGCAGAGCACAGGCAGGGGCGG - Exonic
1149906785 17:60533872-60533894 AGGGAGAGAAGAGGGACTAAAGG + Intergenic
1150286764 17:63959185-63959207 AGGGTGGGCACAGGGATGGGAGG - Intronic
1150541391 17:66103824-66103846 AGGAAGAGCACAGTGATTGTGGG + Intronic
1151059233 17:71071852-71071874 AGGGAGACCAGAAGAACTGGAGG + Intergenic
1151120856 17:71791265-71791287 AGAGAAAGCCCAGGGATTGGAGG - Intergenic
1151390336 17:73782815-73782837 AGGGAGAGCCTGGGGACTGAAGG - Intergenic
1151688067 17:75661317-75661339 AGGAAGAGCACAGGCTTTGGAGG - Intronic
1152024037 17:77797137-77797159 AGGGGGAGCTCAGGGACGGCAGG + Intergenic
1152296365 17:79469489-79469511 AGGGACGGCACAGGGAATGTAGG - Intronic
1152324187 17:79626127-79626149 TGGGAGAACACAGGAAGTGGGGG + Intergenic
1152430560 17:80246312-80246334 CGGGACTGCACAGGGACTTGGGG + Intronic
1152524987 17:80883501-80883523 AGGGTGAGCTCTGGGGCTGGGGG - Intronic
1152644281 17:81461599-81461621 AGGAAGAGGACACGGACAGGCGG - Exonic
1152659901 17:81537311-81537333 ATGGGGAGGACGGGGACTGGGGG + Intergenic
1152753677 17:82078120-82078142 CGGGAAAGCGCTGGGACTGGCGG - Intergenic
1152963515 18:95532-95554 TGGGAGCGCTCAGGGACTGGGGG + Intergenic
1153356707 18:4144413-4144435 AGGGAGAACACAGTGATTGTGGG - Intronic
1153763426 18:8353127-8353149 AGGGAAAGCACAGGAAGGGGAGG + Intronic
1153765370 18:8369556-8369578 AGGAAGAGCGCAGTGACTGTGGG + Intronic
1154014886 18:10607515-10607537 AGGGAAAGCAAAGGGGCTTGGGG + Intergenic
1154085983 18:11305889-11305911 AGGGAGAGCACAGCAACTGGGGG - Intergenic
1154190606 18:12228063-12228085 AGGGAAAGCAAAGGGGCTTGGGG - Intergenic
1155195958 18:23474769-23474791 ATAGAGAGCTCAGGGACTGATGG - Intronic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1155792757 18:29995471-29995493 AGGGAGCGCATAGTGACTGTGGG + Intergenic
1156053497 18:32969321-32969343 AGGGGAAGCAAATGGACTGGGGG - Intronic
1156977356 18:43238629-43238651 AGGGGCAACACAGTGACTGGAGG - Intergenic
1157324183 18:46657257-46657279 TGGGAGGGGACAGGGACAGGAGG - Intergenic
1157336100 18:46738705-46738727 ATTGGGACCACAGGGACTGGAGG - Intronic
1157528633 18:48404399-48404421 AGGGTGGGCACAGGGAGTGAAGG + Intronic
1158025099 18:52886464-52886486 ACAGACAGCACAGCGACTGGGGG - Intronic
1158439843 18:57465996-57466018 AGGGTGAGCACAGGTACAAGAGG - Intronic
1158466799 18:57697734-57697756 AAGCCGAGCACAGGGGCTGGGGG + Intronic
1159564856 18:70036979-70037001 AGGGAGAGAGCAGCGACTGGGGG + Intronic
1160009083 18:75090013-75090035 AGGGAGAGCACAGTCAGAGGTGG + Intergenic
1160143924 18:76348772-76348794 CAGGAGAGGACAAGGACTGGAGG - Intergenic
1160559669 18:79748364-79748386 AGGGACCGCGCAGGGCCTGGGGG + Intronic
1160579696 18:79876479-79876501 AGGGACAGGACAGGGGCTGCAGG + Intronic
1160783594 19:889556-889578 ATGGAGAGGAGAGGGGCTGGCGG + Intronic
1160976106 19:1793476-1793498 AGGGAGGGGCCTGGGACTGGGGG - Intronic
1161283903 19:3459232-3459254 GGGGAGAGTCCATGGACTGGGGG - Intronic
1161462937 19:4409648-4409670 AGGGAGAGCTCAGGGACGAATGG - Exonic
1161467462 19:4439590-4439612 AGGGAGGGCCCAGTGACTTGAGG + Intronic
1162053834 19:8051105-8051127 AGCCAGGACACAGGGACTGGGGG - Intronic
1162126053 19:8500037-8500059 GGGGAGGGCAGTGGGACTGGAGG - Intronic
1162319460 19:9962592-9962614 AGGGGAAGCACAGGGCATGGTGG - Intronic
1162558564 19:11402513-11402535 AGGTAGGGGACAGGGCCTGGGGG + Exonic
1162585486 19:11555664-11555686 AGGGAGAGAGGAGGGACAGGTGG + Intronic
1163216309 19:15879814-15879836 CGGGAGATGACCGGGACTGGGGG + Exonic
1163220498 19:15914812-15914834 CGGGAGATGACCGGGACTGGGGG + Exonic
1163228580 19:15981384-15981406 CGGGAGATGACAGGGACTGGGGG + Intergenic
1163400136 19:17087179-17087201 AGGGAGACCCCAGGGCCTGGAGG + Intronic
1163408935 19:17141406-17141428 GGGGAGGGCACAGGGGCAGGGGG - Intronic
1164572593 19:29385179-29385201 AGGGTGAACACAGGAACTGGAGG + Intergenic
1164775758 19:30852378-30852400 AGCGAGAGCAAAGGGAATTGAGG - Intergenic
1165150317 19:33756511-33756533 AGGGAGGTCTCAGGGAATGGAGG - Intronic
1165186042 19:34022675-34022697 AGGGAGAGACAAGAGACTGGTGG - Intergenic
1165242798 19:34481527-34481549 GGGGAGAGCCCAGGGTCTGCGGG - Intergenic
1165259500 19:34599734-34599756 AGGGAGAGAACAGGGCGGGGAGG - Intronic
1165311850 19:35033341-35033363 AGGGAGGGCACAGGGGTGGGGGG - Intronic
1166301859 19:41915587-41915609 GGGGACAGGACAGGGACTTGAGG - Intronic
1166305029 19:41932616-41932638 GGGGAGAGCAGAGGGAATGGGGG + Intergenic
1166348548 19:42182362-42182384 AGGAAGAGAACAAGGACAGGAGG + Intronic
1166935366 19:46329360-46329382 AGGGAGGGCTCAAGGGCTGGAGG - Exonic
1167246349 19:48375578-48375600 AGGGAGAGAAAAGGGGCAGGGGG - Intronic
1167430353 19:49450721-49450743 AGGGAGAGGACAGAGAGAGGAGG - Intronic
1167567113 19:50263451-50263473 AGGGAGAGGATAGGGCCTTGGGG + Intronic
1167793469 19:51694446-51694468 AGGGAGGGAGCAGGGGCTGGGGG - Intergenic
1167895110 19:52574291-52574313 AGTGAGATGACAGGGACTGAGGG - Intronic
1168521036 19:57050697-57050719 AGGGAGGGCAAAAGGGCTGGAGG - Intergenic
1202712623 1_KI270714v1_random:26301-26323 TCGGAGAGCACAGGCTCTGGAGG - Intergenic
925115313 2:1373744-1373766 AGGGAGAGCGGAGAGACTGTGGG - Intergenic
925306010 2:2848833-2848855 AGGGAGAGGGGAGGGCCTGGGGG + Intergenic
925420613 2:3707719-3707741 AGGGTGGTCTCAGGGACTGGTGG - Intronic
926075007 2:9935443-9935465 AGGGAGAGCAGATGGGCAGGTGG + Intergenic
926312726 2:11686283-11686305 AGGGACAGCCCAGGGGCTGTGGG - Intronic
926518750 2:13883412-13883434 AGGGAGAGCACAGTGATTGCGGG + Intergenic
926724234 2:15984760-15984782 TGGGCGAGCGCAGGCACTGGGGG + Intergenic
927108731 2:19849193-19849215 AGGGAAAGCTCAGGGAATGGAGG + Intergenic
927638377 2:24831967-24831989 GGGCAGCGGACAGGGACTGGGGG + Intronic
927711797 2:25330749-25330771 CGGGAGAGCAGAGGGCATGGGGG - Intronic
927743951 2:25598721-25598743 AGGTTGAGGATAGGGACTGGGGG + Intronic
928204927 2:29277112-29277134 ATGGAGAGAACAGGGCCTGCAGG + Intronic
928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
928847610 2:35696689-35696711 AGGGAGAGCAAAGTGACTGGGGG - Intergenic
929511412 2:42568592-42568614 AGGGAGGGGACAGGGGGTGGGGG - Intronic
929600929 2:43204119-43204141 AGGAAGAGGACAGGCAGTGGGGG + Intergenic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930439784 2:51391220-51391242 AGGGAGAGTACAGTGACTGGGGG - Intergenic
930895546 2:56441412-56441434 AGGTAGAGCACAGTGATTGTGGG - Intergenic
931087960 2:58854793-58854815 GGGCAGAACACAGGGACTGCAGG + Intergenic
931417953 2:62099156-62099178 AGAGAGAGCAGAGGGTCAGGAGG + Intronic
932129983 2:69178579-69178601 AGGGAGGGGCCAGGGACTAGAGG + Intronic
932517456 2:72367732-72367754 AGGGAGAGTGCAGCAACTGGGGG + Intronic
932651923 2:73567132-73567154 GGGGAGGGGACAGGGACTGCAGG - Intronic
933727916 2:85436903-85436925 GGGGACAGCACAGGCACTGCTGG + Exonic
934027178 2:88010778-88010800 AGGGAGGGGACAGGGGCTGAAGG - Intergenic
934197166 2:89848189-89848211 GGAGAGAGCACAGGGAATGTAGG - Intergenic
935128414 2:100243350-100243372 TGGCAGAGCACAGGGCCTGCTGG - Intergenic
935750840 2:106232568-106232590 AGGGAGAGCACAGCAACTGGAGG + Intergenic
936641539 2:114317355-114317377 AAGGAGAGCTCAGCGACTGGGGG - Intergenic
937090708 2:119204607-119204629 TGGCAGTGCACAGGGAGTGGTGG + Intergenic
937291431 2:120784507-120784529 AGGGAGGGCACAGGCCTTGGGGG + Intronic
937613670 2:123893905-123893927 AGGGAGAGTGCAGATACTGGGGG - Intergenic
938133894 2:128738170-128738192 AGGGACAGCAGTGGGACGGGAGG - Intergenic
940041517 2:149366562-149366584 AAGAAGAGTCCAGGGACTGGGGG + Intronic
940639566 2:156332607-156332629 AGGGAGGGAGCAGGGACAGGCGG + Exonic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
940803433 2:158157681-158157703 AGGGAGAACACTGGGAGTGGGGG - Intergenic
941047642 2:160694739-160694761 AGGGAGAGTGCAGTGACTGGTGG - Intergenic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
942530916 2:176909380-176909402 GGTGAGAGCACAGGTAATGGTGG - Intergenic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
942945477 2:181667542-181667564 AGGGAGGGGAAAGGGGCTGGAGG + Intronic
942972378 2:181971868-181971890 AAGGAGAGCAAAGGGATTGTGGG - Intronic
943117607 2:183692442-183692464 AGGGAGAGCACAGTGAATGGGGG - Intergenic
943177104 2:184490663-184490685 AGGGAGAGCAGAGAGATTGGGGG + Intergenic
943237335 2:185338843-185338865 AGAGAGAGCACAGTGACTGTGGG - Intergenic
943867047 2:192938491-192938513 AGGGAGAGTGCAGTGACTGAGGG - Intergenic
943913010 2:193592441-193592463 AGGGAGAGGACCGTGACTGGGGG + Intergenic
943933490 2:193885306-193885328 AGGGAGAATAAAGTGACTGGTGG + Intergenic
944096050 2:195968931-195968953 AGGGACAGCGTAGTGACTGGGGG - Intronic
946996531 2:225398649-225398671 AGGGAGAGCATTGGGATAGGGGG + Intergenic
947096828 2:226575991-226576013 TGGGGGAGCACAGGAACTTGGGG - Intergenic
947505344 2:230704243-230704265 AGGGAGAGCACAGTGATTGCAGG - Intergenic
948569155 2:238906718-238906740 AGGGAGGCCCCAGGCACTGGGGG - Intronic
948654090 2:239466015-239466037 AGGGAGGTCACAGGCTCTGGGGG + Intergenic
948774555 2:240277081-240277103 AGGGAGAGAGCAGTGACTGTGGG + Intergenic
948892671 2:240915016-240915038 AGGGAGGGCGCAGGGACTGTAGG - Intergenic
948903763 2:240968335-240968357 AGGGAGGCCACAGGGCCGGGAGG + Intronic
948979440 2:241485505-241485527 GGGGAGATCACAGGGAGTGAGGG - Intronic
949043773 2:241860968-241860990 CTGGAGAGCACAGGGCCTGCAGG + Intergenic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1168958204 20:1849322-1849344 AGGGAGAGCAGAGGGAGCTGTGG - Intergenic
1169066853 20:2698572-2698594 ATGTAGAGGAAAGGGACTGGTGG + Intronic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170668266 20:18405886-18405908 AGGGAGAGCACAGTGACTGGGGG + Intronic
1171009891 20:21503467-21503489 AGGGAGTGCACAGGGGCTGTGGG + Intergenic
1171819704 20:29823564-29823586 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1171898116 20:30829615-30829637 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1172233477 20:33352973-33352995 AAGCAGAGAACAGGGACTTGGGG + Intergenic
1172506920 20:35469736-35469758 AGGGAGTGCAGACGGGCTGGGGG + Intronic
1172846775 20:37934332-37934354 GGGGAGAGAACATGGAGTGGAGG + Intronic
1173001835 20:39110501-39110523 AGGGAGAGCACAGGGGAAGCAGG - Intergenic
1173843992 20:46176723-46176745 AGGGAGGGCACAGGGAAGGAAGG + Intronic
1174197775 20:48785718-48785740 AGGGAAAGCAGAGGGGCTGCTGG - Intronic
1174209770 20:48868188-48868210 AGGGAGACAAGAGGGAGTGGTGG + Intergenic
1174477370 20:50805578-50805600 AGGGAGACAACAGGGAGGGGTGG - Intronic
1175064333 20:56272496-56272518 GGGGAGAGGACAGGCAGTGGGGG - Intergenic
1176060892 20:63172497-63172519 GGGGGGGGCACAGAGACTGGGGG + Intergenic
1177212768 21:18091042-18091064 AGGGAAAGCACAGCACCTGGGGG + Intronic
1177565904 21:22819330-22819352 AGGGAGAGCCCAGGCAGAGGAGG + Intergenic
1177969959 21:27777480-27777502 AGCGAGAGCACAGTGCCTGGGGG + Intergenic
1178421185 21:32444682-32444704 AGGGAGAGGAGAGGAACTGAAGG - Intronic
1178624473 21:34203641-34203663 AGGCACAGAACAGGGCCTGGAGG - Intergenic
1178640116 21:34338688-34338710 AGGGAGAGCGAAGGGTCGGGAGG - Intergenic
1178758181 21:35373286-35373308 TGTGAGAGCACAGGGGGTGGGGG - Intronic
1179519378 21:41932083-41932105 AGGGAGGGCAGAGGGGCTAGAGG + Intronic
1179643422 21:42761359-42761381 AGGGACTGCAGAGGGACAGGAGG + Intronic
1180323704 22:11348255-11348277 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1180595993 22:16973774-16973796 AGGAAGAGCACAGGGTCTGCTGG - Intronic
1180796549 22:18608614-18608636 TGGGAAAGCCCAGGGAGTGGTGG - Exonic
1180907651 22:19426146-19426168 AGGGAGATCACAGGTGATGGAGG - Intronic
1180987425 22:19913080-19913102 AGGGAAAGCAAATGGGCTGGGGG - Intronic
1181130122 22:20726346-20726368 AGGGGGAGCAAGGGGACTGCTGG + Intronic
1181225174 22:21386657-21386679 TGGGAAAGCCCAGGGAATGGTGG + Exonic
1181253458 22:21548156-21548178 TGGGAAAGCCCAGGGAATGGTGG - Exonic
1181603355 22:23965290-23965312 GGGGAGAGGGCAGGGACAGGTGG - Intergenic
1181605159 22:23976017-23976039 GGGGAGAGGGCAGGGACAGGTGG + Intronic
1181922817 22:26333760-26333782 AGGGTGAGCACAAGGGCTGCAGG + Intronic
1182218937 22:28742542-28742564 AGGGAGACGAACGGGACTGGAGG + Intronic
1183191428 22:36324101-36324123 AGGGCGAGCACAGGCAATGGAGG - Intronic
1183247989 22:36708753-36708775 AGGATGAACACAGGGACTGTGGG - Intergenic
1183287600 22:36977266-36977288 AGGGAGACCACGGGGGATGGAGG + Intergenic
1183456026 22:37923850-37923872 GGGGAGAGCTCAGGGGCTTGGGG + Intronic
1183469558 22:37998297-37998319 AGGGAGTTAACACGGACTGGAGG - Intronic
1183700258 22:39447085-39447107 AGGCGGAGCACAGGCACTAGCGG - Intergenic
1183700854 22:39450224-39450246 AGGGCAAGCAAAGGGACGGGGGG + Intergenic
1183924613 22:41197222-41197244 AGGGAGGGGACAGGGGCCGGTGG - Intergenic
1184335490 22:43850589-43850611 AGGGAGAGCAGAGGGAACAGGGG - Intronic
1184462055 22:44644329-44644351 GGTGAGTGCACAGGCACTGGTGG + Intergenic
1184502460 22:44882378-44882400 AGGAAGGGCACAGGCTCTGGCGG + Exonic
1184724101 22:46333075-46333097 AGGGAGGTCACAGGGCCTGTGGG - Intronic
1185002371 22:48253701-48253723 AGGGAGGGAAGAGGGGCTGGAGG + Intergenic
1185245278 22:49769949-49769971 GGGGAGAGGACAGGGGCTGCAGG - Intergenic
1185359522 22:50397240-50397262 AGGGAGAGCAAGAGGACTAGGGG + Intronic
949962388 3:9323194-9323216 AGGGACAGCACAGGGAGTTTTGG + Intronic
950050922 3:9988839-9988861 AGAGAGAGAAGAGTGACTGGAGG - Intronic
950058011 3:10043956-10043978 AGAGAGAGAAGAGTGACTGGAGG - Intronic
950124886 3:10505027-10505049 AGGGAGACCAAGAGGACTGGAGG - Intronic
950151746 3:10692849-10692871 AGTGAGTGCACAGTGTCTGGCGG - Intronic
950299187 3:11860602-11860624 AGAGAGAGAAGAGTGACTGGAGG - Intergenic
950495847 3:13333940-13333962 AGGGAGAAAACAGGGAGTGGCGG + Intronic
950739018 3:15034808-15034830 AGGTAGGGCACAGGGACTTGGGG + Exonic
950938952 3:16873980-16874002 AGGGAGTACACAGGGACTCTGGG - Intronic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951129822 3:19029372-19029394 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
951255053 3:20439051-20439073 AAGGAGAGGACAATGACTGGGGG + Intergenic
951437096 3:22677188-22677210 AGGGATAGCACAGTGATTGTGGG - Intergenic
952066559 3:29577719-29577741 AGGGAGAATACAGCAACTGGGGG - Intronic
952132930 3:30385222-30385244 AGGGAGAGTACAGCAACTGTGGG - Intergenic
953528259 3:43713508-43713530 TGGGAGAGCAGTGGGACTGCAGG + Intronic
953687781 3:45091586-45091608 ATGGAGAGGAAAGGGAGTGGTGG + Intronic
953750108 3:45602276-45602298 AGGGTGAGCACAGGGGCTTCAGG - Intronic
953907070 3:46873740-46873762 AAGGAGTGCAGTGGGACTGGGGG + Intronic
954411833 3:50374289-50374311 GGGGAGAGGAGAGGGACAGGAGG + Intronic
954491478 3:50910709-50910731 AGGGAGAACAAAGTGACTGTGGG - Intronic
954584244 3:51720166-51720188 AGGGAGAGCCAAAGGCCTGGGGG + Intergenic
954688868 3:52385271-52385293 AGAGAGAGCACAGGGCCTGCTGG - Intronic
954717643 3:52534253-52534275 AAGGAGAGCACCAGGACTAGGGG - Intronic
954873706 3:53786892-53786914 ACGGAAAGAACAAGGACTGGTGG + Exonic
955130163 3:56158005-56158027 AGGGAGAGGGCAGGGACTGCTGG + Intronic
955926092 3:64006546-64006568 AGGAATAGGACAGGGAATGGAGG + Intergenic
956458055 3:69443160-69443182 AGGGAGGGGAGAGGGGCTGGAGG + Intronic
956531688 3:70226879-70226901 AAGGAGAGAAGAGGGACTGGTGG + Intergenic
957050202 3:75405857-75405879 AGGGAGAGGAGAGGAACTGAAGG + Intergenic
957087239 3:75692392-75692414 ACGGAGAGCACAAGGACTGGAGG + Intergenic
957485589 3:80858413-80858435 AGGGAGAGCACAGTGATTGAGGG + Intergenic
957538098 3:81532020-81532042 AGGGAAAACACAGTGACTGTGGG - Intronic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
958670522 3:97197976-97197998 AGGGAGAGCACGGTGATTGTAGG - Intronic
959126059 3:102291325-102291347 AAGGAGAGCACAGTGATTGTGGG - Intronic
959191072 3:103112399-103112421 AGGGAGACTGCAGTGACTGGGGG + Intergenic
959868576 3:111300352-111300374 AAGGAGAGCACAGTGATTGTGGG - Intronic
960404029 3:117238062-117238084 AGGGACAGCACAGTGATTGTGGG + Intergenic
960786089 3:121373831-121373853 GTGGAGTGCACAGAGACTGGTGG - Intronic
961161521 3:124730642-124730664 AGGGAAAGGACAGGGCTTGGTGG + Intronic
961394654 3:126578533-126578555 AGACAGAGCCCAGGGTCTGGTGG - Intronic
961882517 3:130072294-130072316 AGGGAGAGGAGAGGAACTGAAGG + Intergenic
962346627 3:134623692-134623714 GGGCAGTGCACAGGGGCTGGAGG - Intronic
962709018 3:138070126-138070148 AGGGAGGGGACAGGGACTTGGGG - Intronic
962731152 3:138284820-138284842 AGACAGAAGACAGGGACTGGAGG - Intronic
962978527 3:140467126-140467148 AGGTTGAGGACAGGGACTTGAGG + Intronic
962997976 3:140650720-140650742 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
963154023 3:142077043-142077065 AGGGAGAGCTCAGTGACTGTGGG + Intronic
963509632 3:146230685-146230707 AGGGAAAGGAGAGGGACAGGAGG + Intronic
963528851 3:146447985-146448007 AGGGAGAACACAGTGATTGTGGG - Intronic
963547431 3:146677649-146677671 AAAGAGAACACAGGGACTGAGGG - Intergenic
963820502 3:149887170-149887192 AGCGAGAGCACAGTGACTAGAGG + Intronic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964627725 3:158775611-158775633 GGGGAGGACCCAGGGACTGGTGG + Intronic
965027096 3:163316168-163316190 AGTGAGAGCAAAGTGATTGGAGG - Intergenic
965187772 3:165487490-165487512 AGGGAGGGGAGAGGGACTGGAGG + Intergenic
965256984 3:166425751-166425773 AAGGAGAGCACAGTGACAGTGGG + Intergenic
965322379 3:167265893-167265915 AGGGAGAGCACATCAACTAGAGG - Intronic
965415299 3:168385161-168385183 AGGGAGAGCGCACTGAATGGGGG - Intergenic
965535362 3:169818169-169818191 AGGGAGAGGAAAGTGACTGTGGG - Intergenic
965903717 3:173676283-173676305 AGGCAGATCAACGGGACTGGAGG + Intronic
967221747 3:187253187-187253209 CGGGAGAGAACCGGGGCTGGAGG - Exonic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
968073318 3:195801812-195801834 AGGGAGAGCACGTGGAGGGGGGG - Intronic
968542083 4:1172859-1172881 AGGGAGGGGACAGGGAGGGGAGG - Intronic
968663687 4:1809613-1809635 AGGGAGAGCAGAGGGGATGGGGG - Intergenic
968788726 4:2644221-2644243 AGGGAGAGCAAAGTGGGTGGGGG - Intronic
968809587 4:2793811-2793833 AGGGGTGGCAGAGGGACTGGAGG + Intronic
969138546 4:5050517-5050539 AGGTAGGGGACGGGGACTGGGGG + Intergenic
969229802 4:5822033-5822055 GGGGGGAGCCCAGGGACTGAGGG - Intronic
969267962 4:6077948-6077970 AGGGTGACAACAGGGAATGGTGG - Intronic
969544331 4:7814771-7814793 AGAAAGAGCACAGGGGCTGGGGG + Intronic
970026520 4:11629855-11629877 AGGGAGAACACAGAGAAGGGCGG + Intergenic
970028253 4:11647552-11647574 TGGAAGAGCTTAGGGACTGGTGG - Intergenic
970442356 4:16092789-16092811 AGAGAGAGCACAGTGGCTGGGGG + Intergenic
970778322 4:19704352-19704374 AGGGGCAGGCCAGGGACTGGAGG - Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
972278568 4:37582066-37582088 AGGGAGAGTACAGTGATTTGGGG - Intronic
972551961 4:40142114-40142136 AGGGAGACCATAGGGAGAGGGGG + Intronic
972928330 4:44040054-44040076 AGGAAGAGCATAGTGACTGGGGG + Intergenic
973192493 4:47401518-47401540 AGAGAGAACCTAGGGACTGGTGG - Intronic
973227407 4:47802003-47802025 AGGGAGAGCACAGCAACTGGGGG + Intronic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
973763206 4:54139672-54139694 AGGGAGAGCACAGCAACCGGGGG + Intronic
973915261 4:55627153-55627175 AGGGATATGACAGGTACTGGTGG + Intronic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
975629561 4:76386777-76386799 AGGGAGAGCACAGCAACTGGGGG + Intronic
975696480 4:77019086-77019108 AGGGAGAAGATAGAGACTGGTGG + Intronic
976030147 4:80741995-80742017 ATGGAGAGCACAGCAAATGGGGG - Intronic
976266778 4:83192586-83192608 AGGGAGAGAACAGGGGCTGAAGG + Intergenic
976318566 4:83685741-83685763 AGGGAGAGGACAGGGCCAAGAGG - Intergenic
976556974 4:86461324-86461346 GGGGAAGGCACAGGGTCTGGAGG + Intronic
976721951 4:88177769-88177791 AGGGAGAGCACAGCGATTATGGG + Intronic
978096419 4:104784456-104784478 AGAGAAAGCACAGAGACTGTGGG - Intergenic
978478245 4:109157137-109157159 AGGAAGAGCACAGTGACTGAAGG + Intronic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
978934726 4:114360283-114360305 AGGGAGAGCACAGAGACTGCCGG - Intergenic
979213391 4:118133372-118133394 AGGGAGAGCACAGTGACAGGGGG - Intronic
979396626 4:120197209-120197231 AGAGAAAGTACAGGCACTGGGGG + Intergenic
979717727 4:123861897-123861919 AGGAAGAGCACTGATACTGGAGG - Intergenic
979945725 4:126829535-126829557 AGGGAAAGCACAGTGATTGCGGG + Intergenic
980442487 4:132867115-132867137 AGGGAGAACACAGCAACTGGAGG + Intergenic
981005655 4:139872547-139872569 ATGGAAAGCAGAGGAACTGGAGG + Intronic
981061404 4:140429046-140429068 AGAAATGGCACAGGGACTGGAGG - Intergenic
981140122 4:141258677-141258699 AGGGAGAACACAGTGATTGTGGG + Intergenic
981530910 4:145752945-145752967 AGTGAGAGCACAGCGATTGTGGG - Intronic
982670478 4:158314259-158314281 AGGGTGAGTAAAGGGACTAGGGG - Intergenic
982817657 4:159906741-159906763 AGTGAGAGCACAGTGACTGTAGG + Intergenic
982899626 4:160981601-160981623 AGGCAGAGCACAGAGACTGGGGG - Intergenic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983417627 4:167479369-167479391 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
984150470 4:176123810-176123832 AGGGAGGGAAGAGGGACTGAAGG - Intronic
985485383 5:145760-145782 GGGGAGAGACCAGGGACAGGGGG + Intronic
985512707 5:321456-321478 AGGGGGAACGCAGGGCCTGGAGG + Intronic
985529394 5:424919-424941 AGGGGGACCACAGTGCCTGGAGG - Intronic
985595475 5:785742-785764 AGGGACAGAGCCGGGACTGGGGG - Intergenic
985670916 5:1206206-1206228 AGGGAGAAGCCAGGTACTGGAGG - Intronic
985730318 5:1543860-1543882 AGGGAGGGCAAAGGGAAGGGAGG - Intergenic
986447265 5:7832286-7832308 AGGAAGAGCACAGGGACAAACGG - Intronic
986548242 5:8923625-8923647 AGGAAGAGTGCAGGGACTGTGGG + Intergenic
987145622 5:14988750-14988772 AAGGAGATCACAGGGAGTAGGGG - Intergenic
987266984 5:16266080-16266102 AGGGAGAGCAGATGGAGAGGGGG - Intergenic
987304500 5:16624968-16624990 GGGGAGAGGAGAGGGGCTGGAGG - Intergenic
987374036 5:17217886-17217908 AGGGAGAGCCCGGGGGCTGCGGG - Intronic
988639915 5:33030461-33030483 AGCAAGAGCACAGGTCCTGGGGG + Intergenic
988994426 5:36701054-36701076 AGGGAGATGACAGGGATTGGAGG + Intergenic
990014118 5:51037397-51037419 AGGGAAAGAACAGGCACTCGAGG + Intergenic
990827817 5:59922044-59922066 AGGGAGAGTGCAGCGACTGGGGG + Intronic
990981692 5:61607385-61607407 AGAGAGCTCCCAGGGACTGGAGG + Intergenic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
991947181 5:71910605-71910627 AGTGAGATGACTGGGACTGGAGG + Intergenic
992197815 5:74357117-74357139 AAGGAAAGCACAGGAAGTGGGGG + Intergenic
992213851 5:74506696-74506718 AGATAGAGCACAGGCACTGGAGG + Intergenic
992257263 5:74933441-74933463 AGGGAGAGCACAGGAAATCGGGG + Intergenic
992562464 5:77966066-77966088 AGGCAGACCAGAGGGAATGGTGG + Intergenic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
993144682 5:84078990-84079012 AGGAAGAGGAGAGGGACTGAAGG + Intronic
993233462 5:85270127-85270149 GGGGAGAGGGCAGGGGCTGGAGG - Intergenic
993287454 5:86017133-86017155 ATGGAGAGTACAGTGACTGGAGG - Intergenic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
994330501 5:98499902-98499924 AGTGAGAGCAAAGTGACTGGTGG - Intergenic
995047634 5:107669972-107669994 AGAGAGAGCGCACGGGCTGGGGG - Intronic
995265185 5:110151839-110151861 AGGCAGAGCACAGTGACTGGGGG + Intergenic
995290372 5:110444374-110444396 AGGGAGAGCTCAGTGACTGGGGG - Intronic
995557426 5:113344123-113344145 AGGGAAAGCACAGCAAGTGGGGG + Intronic
996459424 5:123724728-123724750 AGGGAGAGTGCAGCGACCGGGGG + Intergenic
996854202 5:127986939-127986961 AGGGAGAGTCCAAGGACTTGGGG + Intergenic
998373095 5:141673518-141673540 AGGGGGATCATAGGGTCTGGGGG + Intronic
998633920 5:143931481-143931503 AGGGAGAGCACAGAGACTGGAGG + Intergenic
999080915 5:148842923-148842945 AGAAAGAGCACTGGAACTGGGGG + Intergenic
999435385 5:151559454-151559476 AGGAAGAGCACAAGGACTAGGGG + Intronic
999622923 5:153490600-153490622 GGGGAGAGGAGAGGGAGTGGGGG + Intronic
999887403 5:155937995-155938017 AGAAAGAGCACAGGACCTGGAGG - Intronic
1001010950 5:168097856-168097878 AGGAAGAGAATAGGGAGTGGTGG - Intronic
1001200420 5:169711053-169711075 AGGCAGAGCAAAGGAACTGAGGG - Intronic
1001311413 5:170613584-170613606 GGGGAGACCACAGGGAAAGGAGG + Intronic
1001743483 5:174072170-174072192 AGGGAGAGGGCTGGGACAGGTGG - Intronic
1002000731 5:176195061-176195083 GGGCAAAGCACAGGGACTGCAGG - Intergenic
1002057005 5:176603907-176603929 AGGGAGACAAGAGGGAGTGGTGG + Intronic
1002094855 5:176824740-176824762 AGGGAGTGCACAGGCACTGGGGG - Intronic
1002253607 5:177943909-177943931 GGGCAAAGCACAGGGACTGCAGG + Intergenic
1002539837 5:179899155-179899177 AGGGTGAGAACAGAGAGTGGCGG + Intronic
1002660844 5:180790377-180790399 AGGGACAGCCCAGGGGATGGGGG - Intergenic
1003527358 6:6909479-6909501 AAGGAGAGCACAGGGCTTTGGGG - Intergenic
1004020008 6:11768854-11768876 TGGGAGAGCACAGAGATTCGTGG - Intronic
1004361405 6:14974351-14974373 AGTGAGAGGATAGGGCCTGGTGG + Intergenic
1004456470 6:15796331-15796353 AGGGAGAGCACAGGGCAGAGTGG + Intergenic
1006089491 6:31620229-31620251 AGAGAGAGGACGGGGGCTGGCGG - Intergenic
1006375733 6:33670823-33670845 GGGGAGTGCCCAGGGGCTGGGGG + Intronic
1006670325 6:35726303-35726325 AGGCAGTGCCCAGGGACTGAGGG + Intronic
1006912203 6:37570749-37570771 GGGGCGAGCACAGGGAGTGCAGG - Intergenic
1006914273 6:37584652-37584674 AGGGTGAGCACAGGGTCGGCAGG - Intergenic
1007637253 6:43306891-43306913 AGGGAAAGAACAGGGACCAGAGG + Intronic
1007689164 6:43687589-43687611 AAGGAGCGCACCGGGGCTGGCGG + Intronic
1008101147 6:47392495-47392517 AGGGAGACAACAGTGACTGTGGG - Intergenic
1008397357 6:51024429-51024451 AAGGGGAGGACAGGGGCTGGAGG - Intergenic
1008440257 6:51524760-51524782 AGGGAGTGCACAGGGAGTTGAGG - Intergenic
1008481484 6:51990384-51990406 AAGGAAAGCAAAAGGACTGGGGG - Intronic
1008707661 6:54182318-54182340 AGGAAGAGCACAGCAACTGGGGG - Intronic
1008940396 6:57040183-57040205 AGGGAAAGCACAGCAACTGGAGG + Intergenic
1009276297 6:61685102-61685124 GGGGAAAGCACAGGGAAGGGAGG + Intronic
1009728137 6:67560547-67560569 AGGGAGAGCAAAGTGATTGTGGG - Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1010540817 6:77089897-77089919 CTGGAGAGCAAAGGGAGTGGAGG - Intergenic
1012072428 6:94639879-94639901 GAGGAGAGCCCAGGGACTGCAGG + Intergenic
1012180263 6:96144016-96144038 AGGAAGAGCACAGGGATTAAGGG - Intronic
1013183004 6:107733732-107733754 AGTGGAAGCACAAGGACTGGTGG - Intronic
1014145173 6:117989147-117989169 GGGGAGTGGACAGGGAGTGGAGG - Intronic
1015460595 6:133487086-133487108 AGGGAGAGCTCAGTGAGTGTAGG + Intronic
1016010352 6:139133091-139133113 AGGCAGAGAACAGAGTCTGGAGG + Intergenic
1016054843 6:139567520-139567542 AGGAAGAGCACAGTGATTGTGGG - Intergenic
1016366599 6:143325309-143325331 AGGAAGAGTACAGGGTCTGAAGG - Intronic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1016814969 6:148294871-148294893 ATATAGAGCACAGGGAGTGGTGG - Intronic
1016998225 6:149976217-149976239 AGGCAGAGCGCAGGGAGTTGGGG + Intergenic
1017751245 6:157492208-157492230 AGGGAGACTACAGTGGCTGGGGG - Intronic
1017924847 6:158901826-158901848 AGGGAGAGCACAGCAACTAGGGG - Intronic
1018349701 6:162943666-162943688 ACGGCGAGCTCAGGCACTGGAGG - Intronic
1019075573 6:169384832-169384854 AGGGTGAGCAGCTGGACTGGTGG - Intergenic
1019254571 7:41030-41052 AGGGAGGGCACAGGCACAGCAGG + Intergenic
1019354225 7:570532-570554 AGGGAGGGCTCGGGGACTGCTGG - Intronic
1019635354 7:2072658-2072680 AAGCAGAGTACAGGGAATGGTGG - Intronic
1019659741 7:2217484-2217506 GGCCAGAGCACAGGGTCTGGAGG + Intronic
1019771029 7:2883662-2883684 GGGGAGAGCACAGGGTAGGGAGG - Intergenic
1020273963 7:6614106-6614128 AGTGTGAGCCCAGGGACAGGAGG + Intergenic
1020279930 7:6644996-6645018 AGGGAGAGCAAGGGAGCTGGGGG - Intronic
1020330482 7:7012340-7012362 AGGGAGTGCACATGAAATGGAGG - Intergenic
1020624195 7:10557901-10557923 AGGGAAAGCACAGCAACTGGGGG + Intergenic
1021214740 7:17901609-17901631 AGGGAGAGCACAGTGATTATGGG - Intronic
1021697388 7:23287885-23287907 AGAGAGAGCCCCGAGACTGGAGG - Intergenic
1021842547 7:24732628-24732650 AGGGAGAGCACAGCAACTGTGGG + Intronic
1021922978 7:25505713-25505735 AGGGACAGCACAATGACTGTAGG + Intergenic
1022444418 7:30457977-30457999 AGGGAGGGCAGAGGGGCAGGAGG + Intronic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1022653323 7:32296972-32296994 ACGGAGAACTCAGGGACTGGAGG + Intronic
1022684271 7:32581157-32581179 GTGGACAGCACAGGGAATGGGGG - Intronic
1022749992 7:33214290-33214312 AGGGACAGCACAGTGACTTGAGG - Intronic
1022798037 7:33748577-33748599 AGAGAGAGTACAGGGAATGGAGG - Intergenic
1023752708 7:43387171-43387193 AGGGAGAACAATGGGATTGGTGG - Intronic
1024055635 7:45658452-45658474 AGGGAGATTACAGGACCTGGGGG - Intronic
1024369222 7:48560323-48560345 AGGAAGAGCACAGTGACTGGGGG - Intronic
1024577663 7:50777914-50777936 AGGGAGGGGAGAGGGACTGAGGG + Intronic
1024956469 7:54926456-54926478 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1025724103 7:64042229-64042251 ACTTAGAGAACAGGGACTGGCGG - Intronic
1026586762 7:71661783-71661805 AGGGAGAGCTGAGGGACTTTGGG + Intronic
1026602287 7:71786820-71786842 GGGGAGGGGACTGGGACTGGCGG - Exonic
1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG + Intronic
1028207662 7:88034819-88034841 AGGGAGAGCACAGCAATTGTGGG - Intronic
1029483204 7:100824994-100825016 GGGGAGGGGACAGGCACTGGAGG + Intronic
1029543922 7:101200500-101200522 AGGGAGAAGAAAGGGCCTGGGGG + Exonic
1030080146 7:105770583-105770605 AGGGACAGCAGAGGAAATGGGGG + Intronic
1031127249 7:117788797-117788819 AGGGAGAACGGAGGCACTGGAGG - Intronic
1031215328 7:118883095-118883117 AGGGAGAGCACAGTGATCGGGGG + Intergenic
1031243857 7:119281647-119281669 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1031721809 7:125186645-125186667 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1031746638 7:125506473-125506495 AGGGAGAACACAGCAACTGGAGG - Intergenic
1031862198 7:126993674-126993696 AGGGAGAGCACAGTGACTGGGGG + Intronic
1032078164 7:128845896-128845918 AGGGAGAGGAGAGGGAAAGGAGG + Intronic
1032128584 7:129211801-129211823 GGGGGGAGCACAGAGGCTGGGGG + Intronic
1032939028 7:136767577-136767599 AGAGAGAGCACAGCAACTGGGGG + Intergenic
1033493185 7:141864553-141864575 AGAGAGGGCAGAGGGACAGGTGG + Intergenic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1033641086 7:143263710-143263732 AGGGAGAGCTCCGGGGCTGAAGG + Intronic
1033647702 7:143317867-143317889 AGTGAGAACACAGGGCCAGGGGG - Intronic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1034232144 7:149538929-149538951 AGGGAGGGGAGAGGGACTGAAGG - Intergenic
1034581920 7:152050925-152050947 AGGGAGAGGGCAGGGATTGTAGG - Intronic
1034757911 7:153640339-153640361 GGGGTGGGCACAGGGAGTGGGGG + Intergenic
1034868094 7:154657814-154657836 AGGGAAAGGAAAGAGACTGGTGG + Intronic
1035138980 7:156738175-156738197 AGGGAGAGCACAACAAATGGGGG + Intronic
1035235826 7:157497143-157497165 AGGGAGAGCAGAGGGAGGGCTGG - Intergenic
1035300739 7:157895915-157895937 AGGGTGAGCACAGAGACTGCAGG + Intronic
1037418240 8:18674285-18674307 AGGGAAGGCCCAGGAACTGGGGG - Intronic
1037650017 8:20827822-20827844 AGGGAGACCATAAGGAGTGGTGG + Intergenic
1037947848 8:23000213-23000235 AGCCAGAGCCCAGGGACTAGCGG - Intronic
1038376225 8:27042790-27042812 ACGGAGAACACAAGAACTGGAGG - Intergenic
1038516674 8:28193467-28193489 AGGCAGAGTCCAGGGCCTGGTGG - Intergenic
1039010682 8:33089726-33089748 AGGGTGAGCATAGGTATTGGAGG - Intergenic
1039211605 8:35222202-35222224 AGGGAGAGCACAGTGAATAAAGG - Intergenic
1039297673 8:36174480-36174502 AGGGAGAGCTCCGGGTCTGGAGG - Intergenic
1039511814 8:38097974-38097996 AGAGAGAGCAGAGGGACAGGAGG - Intergenic
1039568272 8:38566146-38566168 AGGCTGAGCCCAGGGCCTGGTGG + Intergenic
1039865575 8:41498574-41498596 AGTGAGACCTAAGGGACTGGTGG - Intronic
1040289572 8:46117409-46117431 AGCGAGACCACAGGGAATGCTGG - Intergenic
1040300122 8:46183614-46183636 AGCGAGACCACAGGGAATGCTGG - Intergenic
1040300305 8:46184551-46184573 AGTGAGACCACAGGGAATGCTGG - Intergenic
1040303680 8:46201179-46201201 AGTGAGACCACAGGGAATGCTGG + Intergenic
1040307300 8:46218781-46218803 AGCGAGACCACAGGGAATGCTGG - Intergenic
1040313832 8:46250547-46250569 AGCGAGACCACAGGGAATGCTGG + Intergenic
1040314292 8:46252819-46252841 AGTGAGAACACAGGGAATGCTGG + Intergenic
1040325122 8:46337770-46337792 AGTGAGACCACAGGGAATGCTGG + Intergenic
1040329383 8:46378197-46378219 AGTGAGACCACAGGGAATGCTGG + Intergenic
1040329950 8:46380810-46380832 AGGGAGATCACAGGGACTCAGGG + Intergenic
1040331927 8:46390082-46390104 AGCGAGACCACAGGGAATGCTGG + Intergenic
1040335073 8:46411969-46411991 AGCGAGACCACAGGGAATGCTGG + Intergenic
1040335206 8:46412615-46412637 AGCGAGACCACAGGGAATGCTGG + Intergenic
1040336205 8:46417334-46417356 AGCGAGATCACAGGGAATGCTGG + Intergenic
1040336695 8:46419664-46419686 AGAGAGACCACAGGGAATGCTGG + Intergenic
1040341900 8:46445318-46445340 AGCGAGATCACAGGGAATGCTGG - Intergenic
1040599743 8:48871439-48871461 AGGGTGAGCCCATGGACAGGAGG + Intergenic
1040721103 8:50324270-50324292 AGGAAGAGCACAGCAACTGAGGG - Intronic
1040795375 8:51284881-51284903 AGGGAGAGGTCAGGGTATGGAGG - Intergenic
1041580013 8:59447673-59447695 AGGGAGAGCACAGCAACTGGGGG - Intergenic
1041582960 8:59483845-59483867 AGAGAGAGCATAGCAACTGGGGG - Intergenic
1041600441 8:59711387-59711409 AGGGAGAGCTCAAGATCTGGTGG - Intergenic
1041744881 8:61197878-61197900 AGGGAGAGAACAGTGACTATAGG - Intronic
1042162520 8:65911820-65911842 AGGGAGTGCACAATGACTAGAGG + Intergenic
1043542776 8:81281307-81281329 AGGGCGAGCAGAGGACCTGGGGG - Intronic
1044635550 8:94320205-94320227 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1044836173 8:96297712-96297734 AGGTGGAGCACAGTTACTGGAGG - Intronic
1045337788 8:101224148-101224170 CTGGAGAGGACTGGGACTGGAGG - Intergenic
1045554858 8:103206323-103206345 AGGGAGAGCTCAGGGAACTGAGG - Intronic
1045592599 8:103614341-103614363 AGGGAGAGCATAGTGACTGGGGG - Intronic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1047256557 8:123217587-123217609 AGGGAGATCACATGGACAGAAGG + Intergenic
1048043731 8:130754224-130754246 AGAGAGAGGACATGGACTGGGGG + Intergenic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1048375111 8:133816509-133816531 AAGGACTGCACAGAGACTGGTGG + Intergenic
1048427787 8:134338768-134338790 AGGGAGAGAAGAGAGGCTGGAGG - Intergenic
1048582954 8:135745525-135745547 AGGGTGATCACAGGGACAGAGGG + Intergenic
1048592953 8:135838436-135838458 AGGGAGAGCAGAGACACTAGAGG - Intergenic
1048830484 8:138472127-138472149 AGAGAGAGGACAGAGACAGGAGG + Intronic
1049196875 8:141320610-141320632 TGGCAGAGCACAGGGCCTCGAGG - Intergenic
1049292345 8:141811063-141811085 AGGGAGGGCAGAGGGGCTGGAGG + Intergenic
1049353511 8:142176720-142176742 TGGAAGACCACAGGGACTGTGGG - Intergenic
1049428696 8:142549385-142549407 AGGGGGAGGGCAGGGCCTGGAGG + Intergenic
1049454156 8:142678541-142678563 GGGGAGAGCACAGTGACCAGAGG + Intronic
1049473977 8:142788403-142788425 AGGCAGAGCTCAGGGCTTGGTGG + Intergenic
1049580115 8:143407267-143407289 AAGGAGAGCTCAGTGGCTGGTGG + Intergenic
1049727021 8:144151771-144151793 AGGGGGAGCACAGAGACGGGAGG - Intronic
1049782491 8:144435321-144435343 AGGAATAGCAGAGGGGCTGGTGG - Intronic
1049790010 8:144468170-144468192 CAGGAGAGCAGAGGGACTGTGGG + Intronic
1051047085 9:12888238-12888260 AGGGAGAGCATAATTACTGGGGG + Intergenic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1052450602 9:28625284-28625306 AGGGAGAACACAGTGACTTAGGG - Intronic
1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054256202 9:62815755-62815777 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054335103 9:63799859-63799881 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1054982462 9:71222757-71222779 AGGCAGAGCACAGTGATTGTGGG + Intronic
1055685306 9:78766964-78766986 AGGAAGTGCACAGGAAGTGGTGG - Intergenic
1056230693 9:84539728-84539750 AGGGAGAACACAGTGATTGTGGG - Intergenic
1056350177 9:85741720-85741742 GGGGAGAGCAGAGGGACGGCCGG + Intronic
1056552017 9:87660008-87660030 AGGGCGTGGACAGGGGCTGGGGG + Intronic
1057542570 9:95989245-95989267 AGGGAGGGAACAGGGGCTGATGG - Intronic
1057550132 9:96046346-96046368 AGGGAGGGCAGAGGGGCTGAAGG + Intergenic
1057624870 9:96668059-96668081 AGGTAGAGCACAGGAACAGTGGG + Intergenic
1057644316 9:96858874-96858896 AGGGAGAGCACAGCAGCTGTGGG + Intronic
1058285363 9:103170065-103170087 AGGGAGAGGGCAGTGACTGTGGG - Intergenic
1058820773 9:108727679-108727701 AGGGAAAGCACAGTGATTGCTGG + Intergenic
1059015591 9:110512210-110512232 GGGGCGAGCAAAGGGACTTGAGG - Intronic
1059395721 9:114032875-114032897 AGGGAGACCACAGAGGCAGGAGG + Intronic
1059403984 9:114088821-114088843 AGGCAGAGCCCAGGGACAGAAGG - Intronic
1059685057 9:116626995-116627017 AGATAGGGCACAGGGGCTGGAGG + Intronic
1059886566 9:118751080-118751102 AGGGACAGCACAGTGATTGTGGG + Intergenic
1060328587 9:122643303-122643325 AGGGAGAGCACAGCAACTGAGGG + Intergenic
1060429454 9:123536762-123536784 AGAGAGAGGACAGGAAATGGAGG + Intronic
1060586743 9:124791145-124791167 AGGGACATCCCAGGGACTGTGGG + Intronic
1060624243 9:125095978-125096000 AGTGAGAGCACAGGGTTGGGAGG - Intronic
1060784477 9:126439289-126439311 AGGGAGCTCACAGGGTCTGCTGG + Intronic
1061080330 9:128365891-128365913 AGGGAGAACACGGGGCCTGTGGG - Intergenic
1061481621 9:130900284-130900306 AGGGCCAGCACAGCGACTGGTGG - Intergenic
1061638142 9:131928557-131928579 AGGGAGAGCACAGCGACTGGGGG + Intronic
1061874216 9:133535858-133535880 GGGGAGAGCTGAGGGCCTGGAGG + Intronic
1062014057 9:134282481-134282503 GGGGAGAGCCCAGAGTCTGGGGG - Intergenic
1062062229 9:134502723-134502745 AGGGCGAGGACACGGCCTGGCGG - Intergenic
1062194189 9:135264013-135264035 GGGGAGAGGGCAGGGAGTGGGGG - Intergenic
1062354315 9:136154512-136154534 TGGGAGAGCGGAGAGACTGGAGG - Intergenic
1062537189 9:137026264-137026286 GGGCAGAGCTCAGGGTCTGGAGG - Intronic
1062734578 9:138128194-138128216 TGGGAGCGCTCAGGGACTGGGGG - Intergenic
1203371376 Un_KI270442v1:308829-308851 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1185633431 X:1534589-1534611 AGGGACAGAAGAGGGGCTGGGGG + Intronic
1186602034 X:11048606-11048628 AGGGAGAGCACAGTGTCTGGGGG - Intergenic
1187579422 X:20592506-20592528 AGGAAGAGCACAGTGACTGGAGG - Intergenic
1187636677 X:21237417-21237439 AGGGAGAACATAGTGACTGTGGG + Intergenic
1188386199 X:29561752-29561774 AGGTAGAGCCCAGGGACCAGGGG - Intronic
1188625199 X:32276065-32276087 AGGGACAGTACAGCTACTGGGGG + Intronic
1188864549 X:35299450-35299472 ACGGAGAGCACAGTGATTGTAGG + Intergenic
1188897346 X:35685821-35685843 AGGGAGATAGCAGTGACTGGGGG + Intergenic
1188972404 X:36633562-36633584 AGGGAGAGCACAGTGATTATGGG - Intergenic
1188974544 X:36657455-36657477 ACAGAGAGCAAAGAGACTGGAGG - Intergenic
1188974775 X:36659978-36660000 AAGGAGAGCACAGAGACTGGGGG + Intergenic
1189294278 X:39908012-39908034 AGGGTGGGCACAGGGCATGGCGG - Intergenic
1189405609 X:40720355-40720377 AGGGAGAGAATAGTGACTGGGGG + Intronic
1189628051 X:42920737-42920759 AGGGAGAGCACAGTGATCGTGGG + Intergenic
1190122597 X:47674549-47674571 AGGGAGAACACAGTGAATGTGGG - Intergenic
1190374467 X:49775451-49775473 AGGGAGAGTGCAGCAACTGGGGG - Intergenic
1190537135 X:51440588-51440610 AGGGACAGCACAGCAACTGGGGG + Intergenic
1191224806 X:58031698-58031720 AGAGAGTGCACAGTGACTAGAGG - Intergenic
1191779093 X:64847557-64847579 AGGGAGAGCAGAGGGCCTTTTGG - Intergenic
1192134944 X:68588515-68588537 AGGAAGAACACAGTGACTAGGGG + Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192544361 X:72001056-72001078 AGGGAGAGCACAGAGATGTGTGG - Intergenic
1193650158 X:84122235-84122257 AGGGAAAGCTCAGCAACTGGGGG + Intronic
1193802349 X:85951912-85951934 AGTGAGAGCATAGCAACTGGGGG + Intronic
1194196733 X:90903554-90903576 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1194309167 X:92282119-92282141 AAGGAGAGAAAAGGGAGTGGGGG + Intronic
1194327792 X:92541352-92541374 AGGGAGAGCACAGTGACCTAGGG - Intronic
1194388930 X:93292459-93292481 AGGGAGAATGCAGTGACTGGGGG + Intergenic
1194842077 X:98754821-98754843 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1194882685 X:99273459-99273481 AGGGAGAATACAGCAACTGGAGG + Intergenic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195601225 X:106751277-106751299 AAGGAGAGCACAGTGATTGTGGG + Intronic
1196141469 X:112267483-112267505 ATGGAGATCACAGAGATTGGAGG - Intergenic
1196182245 X:112704660-112704682 AGGGAGAGCACAGGAACTGAAGG - Intergenic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1196384963 X:115139690-115139712 AGGGAGAGCACAGGGACTGGGGG + Intronic
1196485704 X:116204163-116204185 AGGGAGAGTGCAGCAACTGGGGG - Intergenic
1196510217 X:116500280-116500302 AGAGAGAGCACTGCAACTGGGGG - Intergenic
1196512190 X:116524591-116524613 AGGGAGAGCACAATGATTGGAGG - Intergenic
1196532642 X:116806793-116806815 AGAGACAGCACAGTGACTGGGGG - Intergenic
1196619479 X:117806333-117806355 CAGGAGAGCACAGTGACTGTGGG + Intergenic
1196762706 X:119213898-119213920 AGGGAGAGGTCAGGGACAGTTGG + Intergenic
1197072826 X:122321355-122321377 AAGGAGAGCACAGCAACTGGGGG + Intergenic
1197078296 X:122379061-122379083 AGGGAGAGCACAGTGACTGAAGG - Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197177965 X:123504780-123504802 AGGGAGAGCACAGTGATTTGGGG + Intergenic
1197457903 X:126700979-126701001 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1197623650 X:128779835-128779857 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1197670702 X:129273798-129273820 AGGGAAAGCACAGTGATTGTGGG - Intergenic
1198724785 X:139665474-139665496 AGGGAGATCACAGAAACTGTGGG - Intronic
1198761561 X:140038345-140038367 AGGGAGAGGAAAGTGACTGTGGG + Intergenic
1198761890 X:140040932-140040954 AAGGAGAGCTCAGTGACTAGGGG - Intergenic
1199138997 X:144287957-144287979 AGGGAGAGCACAGCAAGTGAGGG - Intergenic
1199325091 X:146489933-146489955 AGGGAGAGTACAGTGACTGAGGG + Intergenic
1199457509 X:148045030-148045052 AGGGAGAGCACAGTGGTTGTGGG - Intergenic
1199464453 X:148120315-148120337 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1199564422 X:149199338-149199360 AGGGAGATCAGAGGCCCTGGTGG + Intergenic
1199584881 X:149404549-149404571 AGGAAGAGAAGAGGGACAGGTGG - Intergenic
1199795396 X:151191064-151191086 AGGGAGAGCAAAGTGATTGCGGG + Intergenic
1200177207 X:154125533-154125555 AGGGAGGGCACGGTGACTGTGGG + Intergenic
1200370089 X:155715867-155715889 AGGGCAAGCACAGCGACTGGGGG - Intergenic
1200542579 Y:4477755-4477777 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1200636506 Y:5660570-5660592 AGGGAGAGCACAGTGACCTAGGG - Intronic
1200920260 Y:8606866-8606888 AGGGAGAAAAAAGGGACTGGGGG + Intergenic
1200978333 Y:9237858-9237880 AGCTAGAGCACTGGGAGTGGTGG - Intergenic
1201066970 Y:10106251-10106273 AGGGAGGGCACAGTGACTGGAGG + Intergenic
1201760901 Y:17537086-17537108 AGGAAGAGCACAATGACTGAAGG - Intergenic
1201840651 Y:18368904-18368926 AGGAAGAGCACAATGACTGAAGG + Intergenic