ID: 1196385110

View in Genome Browser
Species Human (GRCh38)
Location X:115140598-115140620
Sequence CCTGAATTCTGGCTTGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 200}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196385110_1196385122 29 Left 1196385110 X:115140598-115140620 CCTGCCCCAAGCCAGAATTCAGG 0: 1
1: 0
2: 2
3: 25
4: 200
Right 1196385122 X:115140650-115140672 CAAGCTGATTGAAGAGCCCTTGG 0: 9
1: 155
2: 332
3: 659
4: 1235
1196385110_1196385123 30 Left 1196385110 X:115140598-115140620 CCTGCCCCAAGCCAGAATTCAGG 0: 1
1: 0
2: 2
3: 25
4: 200
Right 1196385123 X:115140651-115140673 AAGCTGATTGAAGAGCCCTTGGG 0: 6
1: 170
2: 344
3: 544
4: 1019
1196385110_1196385118 -6 Left 1196385110 X:115140598-115140620 CCTGCCCCAAGCCAGAATTCAGG 0: 1
1: 0
2: 2
3: 25
4: 200
Right 1196385118 X:115140615-115140637 TTCAGGGTGAGTCCCAGGACTGG 0: 1
1: 2
2: 9
3: 213
4: 596

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196385110 Original CRISPR CCTGAATTCTGGCTTGGGGC AGG (reversed) Intronic
901808996 1:11755224-11755246 CCTGGAGCCTGGCTTTGGGCTGG + Intergenic
903148776 1:21390470-21390492 CCTGAATTCTTTCTTGGGCGAGG + Intergenic
903769837 1:25756960-25756982 CCTTCATCCTGGCTTGGGGCAGG - Intronic
904326727 1:29731366-29731388 CCTGACTTCTGCCTTTGAGCTGG - Intergenic
904451020 1:30611775-30611797 CATGAATTCTGGTTGGGGACAGG - Intergenic
905369968 1:37477631-37477653 CCTGCCTTCTGTCCTGGGGCAGG + Intronic
905455666 1:38086255-38086277 CCTCAGTTCTGGCTGGGTGCAGG - Intergenic
905477823 1:38241417-38241439 CCTGAATTTGGACTTGGGGTAGG - Intergenic
905888053 1:41502243-41502265 CCTGGAACCTGGGTTGGGGCTGG - Intergenic
907474970 1:54699592-54699614 CATGAATCTTGGCTTGGGCCGGG - Intronic
911133923 1:94418841-94418863 CCTGAGTGCTGGCTGGGCGCCGG - Intronic
911444821 1:97978542-97978564 CGTGAAAGCTGGATTGGGGCAGG - Intergenic
914264239 1:146024305-146024327 GCTGATTTCAGGTTTGGGGCAGG + Intergenic
915464708 1:156090034-156090056 GCTGGATGCTGTCTTGGGGCAGG + Intronic
915943000 1:160130630-160130652 CTTGAACTCTGGCATGGGGGAGG - Intronic
915993660 1:160542781-160542803 CCTGAATTCTGACTTGAGGGAGG - Intronic
916835873 1:168544257-168544279 TCTGAATTCAGGCTGGTGGCAGG - Intergenic
916838595 1:168576317-168576339 TCTGAATTCAGGCTGGTGGCAGG + Intergenic
920194110 1:204214575-204214597 CCTGAATTTGGGGTTGGGGCAGG + Intergenic
920535239 1:206732855-206732877 ACTGAATTCTGCCTTGGTTCTGG + Exonic
920561718 1:206943525-206943547 CCACAATTGTGGATTGGGGCAGG + Intronic
920983015 1:210855969-210855991 CCTGCATCATTGCTTGGGGCAGG - Intronic
923315277 1:232773813-232773835 CCTGAATGCTGCCTTGGCGCCGG + Intergenic
923316106 1:232781320-232781342 TCTGAGTTCTGGCTTGAGTCTGG - Intergenic
924491160 1:244539043-244539065 CCTGCCTTCTGGCCTGGGGAAGG - Intronic
1063576414 10:7265911-7265933 CCTGCATTCTAGCTAGGGGAAGG + Intronic
1064416431 10:15154136-15154158 CCAGGATGCTGGCTTGGTGCAGG + Intronic
1067497920 10:46775568-46775590 GATGAAGTCAGGCTTGGGGCAGG + Intergenic
1067596728 10:47564846-47564868 GATGAAGTCAGGCTTGGGGCAGG - Intergenic
1067666418 10:48283382-48283404 CCTGAAATCTGGCGTAGTGCTGG - Intergenic
1068673836 10:59749967-59749989 CCTGCTTTCTGACCTGGGGCGGG - Intergenic
1069851702 10:71409540-71409562 CCTGACTGCTGGCCTGGGGGTGG + Intronic
1070140069 10:73732408-73732430 GATGAAGTCAGGCTTGGGGCAGG - Intergenic
1070659378 10:78293702-78293724 CCTGGCTTCTGGGTGGGGGCTGG + Intergenic
1070923865 10:80205426-80205448 CCTGGGTTCTGCCTAGGGGCTGG + Exonic
1072088623 10:92105060-92105082 TCTAAATTGTGGTTTGGGGCTGG - Intronic
1072278042 10:93841976-93841998 CCTGACTTAGGGCTTAGGGCTGG + Intergenic
1073116389 10:101094160-101094182 CCTGCATCCTGGCTGGGAGCCGG - Intronic
1075676194 10:124297232-124297254 CCTGACCTCTGGCTTGGTTCAGG + Intergenic
1075974964 10:126686904-126686926 CCTGCATTCTGCCTTGTGGCAGG - Intergenic
1077250374 11:1558200-1558222 GATGAAGTCAGGCTTGGGGCAGG + Exonic
1081156741 11:39702576-39702598 ACTGACTTCAGGATTGGGGCAGG - Intergenic
1083711881 11:64554654-64554676 CCTGAATTCTAGCTTTTGGCCGG + Intergenic
1083901491 11:65645630-65645652 CCTTCACTCTGGCATGGGGCTGG + Intronic
1084331551 11:68433398-68433420 CCTCTCTTCTGGGTTGGGGCTGG + Intronic
1085118489 11:73951271-73951293 CCTGTATCCTGGCTTTGGTCTGG + Intronic
1085387068 11:76163546-76163568 CCTGCATGATGACTTGGGGCAGG + Intergenic
1087712180 11:101567047-101567069 GCTGAAGTCTGGCTCGGGGCGGG + Intronic
1088830231 11:113530539-113530561 CCTGAATTTCTGCATGGGGCTGG - Intergenic
1089735576 11:120548283-120548305 CCTGAATTCTGATTTGGGGGTGG + Intronic
1095233979 12:39775478-39775500 CCTGAACTCTGCCTTGGGGAGGG + Intronic
1096477542 12:51917608-51917630 AATGAAGTCTGGCATGGGGCTGG - Intronic
1096666184 12:53167180-53167202 CATGGATACTTGCTTGGGGCTGG - Intronic
1097290875 12:57913916-57913938 CCTGGATGCTGCCATGGGGCCGG + Intergenic
1097629649 12:62044501-62044523 CCTGAATTCTGGCTTACACCAGG + Intronic
1098955668 12:76687323-76687345 CCTCAAATCTGGTTTGGGCCCGG + Intergenic
1100389868 12:94139128-94139150 CTTGCACCCTGGCTTGGGGCTGG - Intergenic
1102516408 12:113449817-113449839 CCTGACTTCTGGCTTCTGGGTGG - Intergenic
1104351153 12:128045030-128045052 CCTGAATTCTTTCTCGGTGCAGG - Intergenic
1106739647 13:32626134-32626156 CTTGAATACTGGTCTGGGGCTGG - Intronic
1117995156 14:61471189-61471211 CATGATTGCTGCCTTGGGGCAGG - Intronic
1117995427 14:61473456-61473478 CATGATTGCTGCCTTGGGGCAGG - Intronic
1119234359 14:73007007-73007029 TCTGAATTCTAAATTGGGGCTGG - Intronic
1119977318 14:79039633-79039655 CATGAATCCTGGCCTGGGGAAGG - Intronic
1124602632 15:31147936-31147958 ACTGAAATCTCGCCTGGGGCTGG + Intronic
1126613308 15:50551415-50551437 CCTGACTTCAGGATTGGGGCAGG - Intergenic
1129296934 15:74604773-74604795 CCTGACTTCAGGCTTGGGGAGGG + Intronic
1130939465 15:88495639-88495661 ACAGGATTCTGGCTTGGGGGTGG - Intergenic
1131140486 15:89973131-89973153 CCTGAATCCTGGCCTGCGACTGG - Intergenic
1132654960 16:1037879-1037901 CCTGAAGGCTGGCCTGGGGCTGG - Intergenic
1133679706 16:8109361-8109383 CATGAATTCTTTCTTGGTGCCGG - Intergenic
1134089954 16:11386235-11386257 CCTGAGCTGTGGCTTGGGGGTGG + Intronic
1135241421 16:20810108-20810130 ACTGATTCCAGGCTTGGGGCAGG - Intronic
1135940009 16:26814466-26814488 CCCCATTTCTCGCTTGGGGCTGG - Intergenic
1136558201 16:31021490-31021512 CCTGAATTCTTTCTTGAGGAAGG - Intergenic
1138068655 16:53968526-53968548 CTTGAATTGTGGCTGTGGGCTGG + Intronic
1138553515 16:57759565-57759587 CCTGACTACTGCCTGGGGGCAGG + Intronic
1140443932 16:75008882-75008904 CCCTATTTCTGGGTTGGGGCAGG + Intronic
1141103537 16:81215132-81215154 CGTGCACTGTGGCTTGGGGCAGG - Intergenic
1141864072 16:86737842-86737864 CCAAAATTCTGGAGTGGGGCTGG - Intergenic
1141932546 16:87215792-87215814 CCTGACTTCTGGTTTGCGGCTGG + Intronic
1144066851 17:11632179-11632201 ACAGAATTCTGACTTGGGGAAGG + Intronic
1144757823 17:17690849-17690871 CCAGCATTCTGGCTTGGGGTGGG + Intronic
1147769524 17:42857695-42857717 CCTGAGGTCTGGATTGGGGATGG + Exonic
1148772288 17:50074384-50074406 CCCCAACTCTGGCCTGGGGCAGG + Intronic
1150430323 17:65110374-65110396 CATCAATTCTGGCTAGGGGTGGG - Intergenic
1152095702 17:78270411-78270433 CCTGATTTCTGGTATGGGGAGGG + Intergenic
1152153704 17:78618948-78618970 CCTGGATGCTGGCTTGGCGGAGG - Intergenic
1152587685 17:81196318-81196340 CCTGGGGTCTGGCCTGGGGCCGG - Intronic
1154339166 18:13488885-13488907 CCTGGATGCTGGCTAGGGTCAGG - Intronic
1155999735 18:32371557-32371579 CCAGATTTCTGGCTTGGGTAGGG + Intronic
1156161370 18:34362345-34362367 CCTAAATTCTGGGTTGGGAGTGG - Intergenic
1157104037 18:44756515-44756537 CCTGGAGCCTGGCTTGTGGCTGG - Intronic
1157292367 18:46419304-46419326 CCTGAGGTCTGGCCTAGGGCTGG - Intronic
1157449427 18:47774089-47774111 CCTGAATGCTGCTGTGGGGCAGG + Intergenic
1160625875 18:80204651-80204673 TCAAAATACTGGCTTGGGGCAGG + Intronic
1161748359 19:6075582-6075604 GCTGACTTAAGGCTTGGGGCTGG + Intronic
1161838935 19:6667079-6667101 CCTGGATCCTGGCAAGGGGCAGG - Intronic
1161852372 19:6744434-6744456 CCTCCAGACTGGCTTGGGGCTGG + Intronic
1161910818 19:7192539-7192561 CCCAAATTCTGGTTTGGGGTAGG + Intronic
1162038535 19:7955532-7955554 TCTGAATTCTGGGGTGAGGCGGG + Intergenic
1162038780 19:7956866-7956888 TCTGAATTCTGGGGTGAGGCAGG + Intergenic
925235411 2:2273120-2273142 CCAGAATTGTGGCAGGGGGCAGG - Intronic
926556523 2:14364246-14364268 CCTGATTCCTCGCTTGGGGTGGG + Intergenic
929053838 2:37859217-37859239 CCTGAACACTGCCATGGGGCTGG - Intergenic
931556942 2:63516656-63516678 TCTGAATGCTGGCCTGGAGCTGG - Intronic
932750354 2:74367665-74367687 CAAGAATTTGGGCTTGGGGCAGG - Intronic
935669821 2:105545531-105545553 TCTGAATTCTGGCTTCGAGACGG + Intergenic
935740524 2:106143614-106143636 CTTGATTTCTGCCTGGGGGCAGG - Intronic
937226829 2:120375074-120375096 CCTGAAGACAGGCTTGGGGCTGG + Intergenic
938248696 2:129797640-129797662 CCTGAATTCTGGCTGGGCCCTGG - Intergenic
942968116 2:181921977-181921999 CCTGAAGTCTGAATTGGGCCTGG + Exonic
945056010 2:205869562-205869584 GATGAATCCTGGCTTGGGACAGG - Intergenic
946360990 2:219219193-219219215 ACGGAATCCTGGCTCGGGGCAGG + Intronic
946536463 2:220635193-220635215 CCTGACTTCTGGGTTGGGAGAGG - Intergenic
946896088 2:224326009-224326031 CCTGAATCCTGGGCTGGAGCTGG + Intergenic
1168904385 20:1392007-1392029 TCTGAATTCTGGCTGGGGAGGGG + Intronic
1170386057 20:15818151-15818173 CCTGAATTCTTCCTTGAGGAAGG - Intronic
1170601270 20:17843349-17843371 ACTGGATTCTGTCTGGGGGCAGG - Intergenic
1173939256 20:46895437-46895459 CTGGAATCCCGGCTTGGGGCTGG + Intronic
1174137480 20:48390618-48390640 GTTGAATTCTGGCTGGGTGCAGG + Intergenic
1174252609 20:49230845-49230867 CCTGAACTCTGGACTGAGGCTGG + Intronic
1174404329 20:50293827-50293849 CCTGATTTTGGGCTGGGGGCCGG + Intergenic
1174426102 20:50432585-50432607 CCTGAATTTTGGCCTGGGAGGGG - Intergenic
1175797144 20:61778854-61778876 CCAGAATTCTGGCTCTGGACTGG + Intronic
1178913133 21:36692657-36692679 AAGGAATTCTGGCTTAGGGCAGG + Intergenic
1181140025 22:20797527-20797549 CCTGAAGACTGGATTGGGGATGG - Intronic
1181275214 22:21683717-21683739 CCTGAGGTCAGGGTTGGGGCTGG + Intronic
1182447011 22:30395760-30395782 GCTGGCTTCTGGCCTGGGGCAGG - Intronic
1183485150 22:38084461-38084483 CCTGGAATGTGGCCTGGGGCGGG - Intergenic
1183930420 22:41232982-41233004 CCTAATTTCTGGCTGGGAGCCGG - Intronic
1184096152 22:42317629-42317651 CCTGCATTCCCGCTGGGGGCTGG + Intronic
1184385512 22:44172167-44172189 CCTGAATTCTGCCTTGGAACTGG - Intronic
1184929903 22:47673238-47673260 GCTGCCTTCTGGCTTGGGGCTGG + Intergenic
1185018162 22:48357803-48357825 GCTGGATTCTGGCTAGAGGCAGG - Intergenic
949437938 3:4049618-4049640 CCTGAATGCTGCCCTGGGGCTGG - Intronic
949933933 3:9102023-9102045 CCTATCTTCTGGCTTGGGCCTGG - Intronic
949966761 3:9363218-9363240 CCTGAAGTCCGGCTCGGCGCCGG - Exonic
952002493 3:28802527-28802549 CTTGAATGCTTGCTTGGGGTGGG + Intergenic
954453459 3:50584215-50584237 CCAGGACTCTGGCTGGGGGCTGG - Exonic
956647039 3:71466257-71466279 CCTTATTTTTGTCTTGGGGCTGG + Intronic
958807327 3:98827433-98827455 CCAGATTTCTGGCATGTGGCTGG - Intronic
960517548 3:118618679-118618701 CCTGTATTCAGGCTTGTGGGTGG + Intergenic
963605228 3:147407330-147407352 ACTAGATTCTCGCTTGGGGCTGG - Intronic
965071958 3:163925539-163925561 CCTTAATTTTACCTTGGGGCAGG + Intergenic
965669864 3:171136188-171136210 CCTAAACTCATGCTTGGGGCTGG + Intronic
969168614 4:5340299-5340321 CCTGAATTGGGGAGTGGGGCAGG + Intronic
971811787 4:31437422-31437444 CTGGAATTATGGCTTGGGGGAGG - Intergenic
971878768 4:32340557-32340579 CCTGAATTCCAGCTGGGGGAGGG - Intergenic
973806216 4:54528321-54528343 CCTGAATTCTCTATTTGGGCTGG - Intergenic
974028824 4:56757529-56757551 CCTGCATTCTGGCTGTGGCCTGG - Intergenic
975753918 4:77553032-77553054 CCTGAATTTTGGCTTGGGGGTGG + Intronic
977337439 4:95716715-95716737 ACTGAATTATGACTTAGGGCTGG + Intergenic
977400050 4:96521172-96521194 CCTGCATTCTGGGTGGGTGCGGG + Intergenic
980669350 4:135983883-135983905 CCTGAATTCCAGCTTTGGGTGGG - Intergenic
981890691 4:149732902-149732924 CCTGAATTCTGTTTTTGAGCAGG - Intergenic
985388986 4:189475010-189475032 CCTGTCTTCTGACTTCGGGCTGG + Intergenic
989155599 5:38342020-38342042 CTTGAATCCTGGATTGGGACAGG - Intronic
989773971 5:45180737-45180759 CCTGATTCTTTGCTTGGGGCGGG + Intergenic
990513257 5:56508700-56508722 CCTGAAATCCTGCTTGGAGCAGG - Intergenic
991136747 5:63191310-63191332 TCTGGAGTCTGGCTTGGGTCGGG + Intergenic
991554965 5:67885385-67885407 TCTGATTTCTGCTTTGGGGCAGG + Intergenic
996529210 5:124510053-124510075 CCTGAATTCTTGACTTGGGCTGG + Intergenic
997225877 5:132209076-132209098 CCTGGACTCTGGCTCTGGGCAGG - Intronic
998553184 5:143097213-143097235 CCTGTAATCTGGGGTGGGGCAGG + Intronic
999025726 5:148230063-148230085 TCAAAATTCTGGCTTGGAGCAGG - Intergenic
999099632 5:149012636-149012658 GCTGAGGCCTGGCTTGGGGCGGG - Exonic
1004469501 6:15916728-15916750 CCTGGATGCTGCCATGGGGCTGG - Intergenic
1005639759 6:27784823-27784845 GCTGAATTTTGGGCTGGGGCAGG + Intergenic
1007172463 6:39873391-39873413 CCTGAACCTTGACTTGGGGCAGG + Intronic
1007793749 6:44330382-44330404 CCTGAAATGTGGTTTGAGGCTGG + Intronic
1008288866 6:49687845-49687867 TCTGCTTTCTGGATTGGGGCAGG + Intergenic
1008572564 6:52829496-52829518 CCCGAGTTCTGGGTGGGGGCAGG - Intergenic
1008587506 6:52962750-52962772 CATGAATTCTGGGTGGGTGCGGG - Intergenic
1009588029 6:65631256-65631278 CCTGAATTCTGTCTGGAGGATGG + Intronic
1011519949 6:88194394-88194416 CCTGAATGGTGCCTGGGGGCTGG + Intergenic
1018647767 6:165963841-165963863 CCTCTATCCTGGCTTGGGCCAGG + Intronic
1019494746 7:1332461-1332483 CCTGGTCTCTGGCTTGGGGCTGG + Intergenic
1019584115 7:1787421-1787443 CCAGAATGCTGGCTTCAGGCTGG + Intergenic
1021362901 7:19738562-19738584 GCTGAATTTTGGACTGGGGCAGG + Intronic
1021839609 7:24712181-24712203 CCTGAATGCTGGTGTGGGCCAGG - Intronic
1022670051 7:32447207-32447229 CCTGATTTCTTACCTGGGGCTGG + Intergenic
1022896909 7:34759574-34759596 GCTGATTCCTGGCCTGGGGCTGG - Intronic
1024799530 7:53059847-53059869 CCTGTATGCTGGCTTTGGGGAGG + Intergenic
1026503828 7:70965386-70965408 TCTGAATACTGGGTTGGGGGAGG - Intergenic
1028977820 7:96933549-96933571 TCTGAAGTCTGACTTGGGGTGGG - Intergenic
1031766209 7:125781062-125781084 CCTAGATGCTGCCTTGGGGCTGG - Intergenic
1032073089 7:128821732-128821754 GGTGACTTCTGGCTTAGGGCAGG + Intronic
1032551548 7:132789025-132789047 CCTGAGTTCTGAGTTGGAGCAGG - Intronic
1034718723 7:153267625-153267647 GCTGAACCCTGCCTTGGGGCAGG - Intergenic
1034964858 7:155384626-155384648 CCTGGATTCTGGTTCAGGGCGGG - Intronic
1035080118 7:156208875-156208897 CCTTAATTCTTGATTGTGGCAGG + Intergenic
1035967566 8:4210200-4210222 CCAGCATGCTGGCTTGGGGAGGG - Intronic
1036645901 8:10611381-10611403 CCTGAATTGGGGCCTGGGGACGG + Exonic
1037981698 8:23258952-23258974 CCTTGATTCTCACTTGGGGCAGG + Intronic
1038490245 8:27965494-27965516 GCTGCATTCTGCCTTGAGGCAGG + Intronic
1039804550 8:40987106-40987128 AGTGAATTCTGCCTTGGGGCAGG + Intergenic
1042461335 8:69072769-69072791 CATGGATTCTGGGTTGGGGATGG + Intergenic
1049194655 8:141308555-141308577 GCTGGATTATGGCTGGGGGCGGG - Intergenic
1049701186 8:144013541-144013563 CCTGAAATGTGGCATAGGGCTGG + Intronic
1051698648 9:19795283-19795305 CCTGAATCCTGGCATTGGGCCGG - Intergenic
1051822989 9:21190870-21190892 CCTGGAGTCTTGCTTAGGGCAGG - Intergenic
1051824813 9:21209405-21209427 CCTGGAGTCTTGCTTAGGGCAGG - Intronic
1051826809 9:21231482-21231504 CCTGGAGTCTTGCTTAGGGCAGG - Intronic
1051923136 9:22291178-22291200 CCTGACTTGTGGCTTGGGTTTGG + Intergenic
1053164323 9:35833849-35833871 CCTGTATACTGGCTCAGGGCAGG - Intronic
1053286936 9:36855734-36855756 CCTGGAATATGGCTTGTGGCGGG - Intronic
1053418080 9:37959220-37959242 CCAGATTTCTGGCTTGGGGGAGG + Intronic
1056137263 9:83642639-83642661 CATAAATTCTGGCTTGGGGCTGG - Intronic
1056458155 9:86783259-86783281 CCTAATTTCTGGGTTGGGGTGGG + Intergenic
1056623213 9:88232719-88232741 TATGACTTCTGTCTTGGGGCTGG - Intergenic
1056761995 9:89422352-89422374 CCTGCTTTCTGGCTTGGGGAGGG + Intronic
1057104325 9:92397273-92397295 GCTGATTTCAGGGTTGGGGCAGG - Intronic
1057583205 9:96306130-96306152 CATGAATTTTGGCTGGGGCCAGG - Intergenic
1058355295 9:104077271-104077293 CCTGAATTCTGTCTTGTGCAAGG - Intergenic
1058637231 9:107048573-107048595 CCTGACTGCTGGGTTTGGGCAGG + Intergenic
1062044564 9:134419019-134419041 CCTCTACTCTGGCTGGGGGCTGG + Intronic
1062339213 9:136086462-136086484 CCTGAGGTCTGGCTTGGTGTGGG + Intronic
1062419437 9:136472733-136472755 CGTGAATTCTGGCGTGTGTCCGG - Intronic
1062548371 9:137074091-137074113 CATGGACTCTGGCCTGGGGCGGG + Intergenic
1186150634 X:6671315-6671337 CCTGAAGTCTTGCGTGGGGCGGG - Intergenic
1187338990 X:18404724-18404746 CCTGAATTGTGTCTTGAGACAGG - Intergenic
1187666173 X:21612421-21612443 ACTGAATGCTGGCCTGGAGCAGG - Intronic
1189920632 X:45900122-45900144 TTAGAATTCTGCCTTGGGGCCGG - Intergenic
1191101938 X:56739062-56739084 CCAGCTTTCTGGCTTGGAGCTGG - Intergenic
1195295028 X:103468106-103468128 AATGAATTCTGTCTTGGGGGAGG + Intergenic
1196385110 X:115140598-115140620 CCTGAATTCTGGCTTGGGGCAGG - Intronic
1196802317 X:119554804-119554826 CCTGAAATCTTGATTAGGGCTGG - Intronic