ID: 1196385998

View in Genome Browser
Species Human (GRCh38)
Location X:115151882-115151904
Sequence CAGGAGACAGAGCTGGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 919
Summary {0: 1, 1: 1, 2: 15, 3: 105, 4: 797}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196385992_1196385998 20 Left 1196385992 X:115151839-115151861 CCAGGAGAAAAAAACTAAGGCAG 0: 1
1: 0
2: 2
3: 34
4: 360
Right 1196385998 X:115151882-115151904 CAGGAGACAGAGCTGGAGCCAGG 0: 1
1: 1
2: 15
3: 105
4: 797
1196385989_1196385998 27 Left 1196385989 X:115151832-115151854 CCACATCCCAGGAGAAAAAAACT 0: 1
1: 0
2: 3
3: 35
4: 444
Right 1196385998 X:115151882-115151904 CAGGAGACAGAGCTGGAGCCAGG 0: 1
1: 1
2: 15
3: 105
4: 797
1196385991_1196385998 21 Left 1196385991 X:115151838-115151860 CCCAGGAGAAAAAAACTAAGGCA 0: 1
1: 0
2: 4
3: 44
4: 471
Right 1196385998 X:115151882-115151904 CAGGAGACAGAGCTGGAGCCAGG 0: 1
1: 1
2: 15
3: 105
4: 797

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196385998 Original CRISPR CAGGAGACAGAGCTGGAGCC AGG Intronic
900108364 1:995734-995756 GAGGAGACAGTCCTGGACCCAGG + Intergenic
900112782 1:1015571-1015593 CCGGACACAAGGCTGGAGCCAGG - Intergenic
900350099 1:2230218-2230240 CAGGAGACAGAGCTTGGGTGAGG + Intronic
900395698 1:2452426-2452448 CAGGAGGGAGAGCAGGAGGCAGG - Intronic
900420878 1:2555472-2555494 CAGGGGCCAGGGCTGGACCCTGG + Intergenic
900474578 1:2870147-2870169 GAGGGGACAGAGCTGGAGCCTGG - Intergenic
900889799 1:5441634-5441656 GAGGAGACAGAACTGAGGCCTGG + Intergenic
900903649 1:5535243-5535265 CAGGACACAGGCCTGGAGGCAGG - Intergenic
900952429 1:5865455-5865477 CAGGAGGCAGAGCTAGGGCCTGG + Intronic
900970797 1:5991754-5991776 CCGGAGCCGGAGCTGGAGCCGGG + Intronic
901097279 1:6692374-6692396 GAGGAGGCAGAGCTGGGGGCAGG - Intronic
901138625 1:7013636-7013658 CAGGTGGCAGAGGTGGAGTCAGG + Intronic
901144531 1:7056133-7056155 AAGGACACAGAGCTGGTCCCCGG + Intronic
901212554 1:7534726-7534748 CAGGGGGCAGAGTTGGGGCCTGG + Intronic
901387744 1:8922146-8922168 AAGGGGACAGAGCTGGAGCAGGG - Intergenic
901423753 1:9168003-9168025 CTAGAGACAGGGCTGGAGCTGGG + Intergenic
901492338 1:9602883-9602905 CAGCAGCCAGAGCTGCAGCTCGG - Intronic
902203950 1:14853681-14853703 CAAGAGACACAGCTGGAGCCTGG - Intronic
902254006 1:15175696-15175718 CAAGAGACAGAGCTTGTGCAGGG + Intronic
902303107 1:15516868-15516890 GTGGAGACAGGGCTGCAGCCCGG - Intronic
902313411 1:15599383-15599405 GAGGAGACAGAGCTGAGTCCAGG + Intergenic
903145412 1:21368886-21368908 CAGGAAACAGACGTGGAGACCGG - Intergenic
903237851 1:21961972-21961994 CAGAGGTCAGGGCTGGAGCCAGG - Intergenic
903419229 1:23206562-23206584 CAGGAAACAGCACCGGAGCCTGG - Intergenic
903419712 1:23209898-23209920 CAGGTGATAGTGATGGAGCCTGG - Intergenic
903771432 1:25766846-25766868 CAGGAGTGTGAGCTGCAGCCTGG + Intronic
903830932 1:26174086-26174108 CAAAAGACAAAGCTGGAGACGGG + Intergenic
903874945 1:26467534-26467556 CTGGAGACAGACATGGAGCAGGG - Intronic
903929840 1:26855866-26855888 CAGCGGACAGAGCTCCAGCCAGG - Exonic
904265024 1:29313189-29313211 CAAGAGAAAGATGTGGAGCCAGG - Intronic
904417300 1:30371202-30371224 CAGGAGACAGAGGGGCTGCCAGG + Intergenic
904490571 1:30856382-30856404 GAGGAGCCAGCGCTGGAGCCAGG - Intergenic
904542378 1:31241661-31241683 CAAGTGACAGTGCTGGAACCGGG - Intergenic
904684126 1:32248494-32248516 CTGGAGCTGGAGCTGGAGCCCGG + Exonic
905469738 1:38182848-38182870 CAGAAGACAGAACTGGAGAGTGG - Intergenic
905860565 1:41348173-41348195 AAGGACACAGAGCTAGAGCCAGG + Intergenic
905887210 1:41497790-41497812 CAGCAAACAGGGCTGGAGCATGG + Intergenic
906294801 1:44643016-44643038 CAGGAGACAGAGCTGTAACTTGG + Intronic
906487813 1:46245322-46245344 CAGGAAACAGAGTTTGAGGCAGG - Intergenic
906532371 1:46531144-46531166 GAAGAGACAGGACTGGAGCCTGG + Intergenic
906617174 1:47241387-47241409 CAGGAGAAGGAGCTGGAGGAAGG - Intergenic
907455561 1:54573112-54573134 CAGGACCCATACCTGGAGCCAGG - Intronic
908144925 1:61230743-61230765 TAGAACACAGAGCTGGAGCAGGG - Intronic
909685181 1:78339817-78339839 CAGGAGAAAGAGCTAGAGCAAGG + Intronic
909786455 1:79620213-79620235 CAGGAGCCTGAGCAGCAGCCAGG - Intergenic
909972064 1:82002580-82002602 GAGGAGACAGTGTTGGAGCTGGG + Intergenic
910731145 1:90398766-90398788 CAGGAGAGAGAGAGGGAGCAAGG + Intergenic
911270639 1:95797377-95797399 CTGGAAACAGGGCTGAAGCCAGG + Intergenic
911975572 1:104489886-104489908 CAAGAGACAGGCCTGGAGTCAGG - Intergenic
912048132 1:105486599-105486621 CAGGAGGCAGAGCTGGACCAGGG - Intergenic
912394315 1:109328947-109328969 CAGGTGAAACACCTGGAGCCCGG - Intronic
912420437 1:109539098-109539120 AAGGAGACAGAGTGGGGGCCAGG - Intergenic
912700300 1:111873293-111873315 CAGGAGACAGAAATCTAGCCAGG + Intronic
914314774 1:146499913-146499935 CAGGTGAGAGTGTTGGAGCCAGG + Intergenic
914379327 1:147102461-147102483 CAGGTGAGAGTGTTGGAGCCAGG + Intergenic
914499577 1:148233475-148233497 CAGGTGAGAGCGTTGGAGCCAGG - Intergenic
914718096 1:150268025-150268047 CAGGAGGCCGTACTGGAGCCGGG + Exonic
914951161 1:152115556-152115578 GTGGAGACAGAGGTGGAGCTGGG - Intergenic
915312890 1:155013330-155013352 CTGGAGACAGTGCTGGGGCTTGG - Intronic
915334207 1:155131129-155131151 CAGGAGACAGTGATGGTGCAGGG + Intronic
915965983 1:160308620-160308642 CAGGAGTCTCAGCTGGATCCTGG + Intronic
916091332 1:161309896-161309918 CAGGAGCCATAGCTGGGGCAGGG + Exonic
917584999 1:176417146-176417168 CTGGAAAGAGAGCTGAAGCCAGG - Intergenic
917836080 1:178942567-178942589 CAGGTCACACAGCTGGTGCCTGG + Intergenic
918363691 1:183784492-183784514 CAGGAGTCAGACCTGGAACATGG + Intronic
919075365 1:192807290-192807312 CAGGAGACCCAGTTAGAGCCTGG - Intergenic
919364963 1:196648325-196648347 CACAAGACATTGCTGGAGCCAGG - Intergenic
919617842 1:199829806-199829828 GAGCATACAGACCTGGAGCCTGG - Intergenic
919667869 1:200310080-200310102 CAAGAGACTGAGATGGGGCCAGG + Intergenic
919954804 1:202403145-202403167 CAGTAGAGAGAGATGGGGCCTGG + Intronic
920435848 1:205946628-205946650 CAGCGGACAGAGAAGGAGCCGGG + Intergenic
922237276 1:223731549-223731571 CAGGAGACAGACGTGGAAACTGG - Intronic
922555210 1:226527532-226527554 CAGATGACAGAGCCAGAGCCAGG + Intergenic
922619912 1:226983076-226983098 CAAGGGGCAGAGCTGGGGCCTGG + Intronic
923027213 1:230214710-230214732 GAGGAGACAGAACTGCAGCATGG - Intronic
923183082 1:231541989-231542011 CAGGAAACTTAGGTGGAGCCTGG - Intronic
923447715 1:234087976-234087998 GAGGAGACTAAGCTGGAGGCAGG - Intronic
1063675590 10:8138515-8138537 CAGGGGACAGAGAAGGGGCCTGG - Intergenic
1063990338 10:11554509-11554531 CAGGGGCCTGAGCTGGAGTCTGG - Intronic
1064038264 10:11934434-11934456 CAGGAGGCCTGGCTGGAGCCTGG + Intronic
1064430111 10:15263241-15263263 CGGGAGCCAGAGCTGCAGGCTGG + Intronic
1064537654 10:16374268-16374290 TGGGAGACAGAGCAGGAGACAGG - Intergenic
1064607884 10:17063078-17063100 CAGGAGACTGAGCTGGTGTTGGG - Intronic
1064724038 10:18259336-18259358 CAGGAGAATGGCCTGGAGCCAGG + Intronic
1064938565 10:20707413-20707435 AAGGACACAGAGCTGGTGCAGGG + Intergenic
1065382220 10:25101961-25101983 CAGGAGATGGAGCTGAAGGCAGG + Intergenic
1065822922 10:29542962-29542984 CCAGAGACAGAGCTGGAGCTTGG - Intronic
1065840999 10:29700984-29701006 CAGGCGGCAGGGCTGGAGCGTGG - Intronic
1066657270 10:37708016-37708038 CAGCAGATGGAGCTGGAGACAGG - Intergenic
1067083551 10:43226658-43226680 CAGGGGTCAGAGCTGGTTCCTGG - Intronic
1067278595 10:44854905-44854927 CGGGAGAGGGAGCTGGAGCCGGG + Intergenic
1067459368 10:46446015-46446037 CAGGACACAGGGCTGCACCCAGG + Intergenic
1067521386 10:47009323-47009345 CAGGAGCCACACCTGCAGCCAGG + Intergenic
1067554895 10:47261881-47261903 AGGTAGACAGAGCAGGAGCCAGG - Intergenic
1067627826 10:47938615-47938637 CAGGACACAGGGCTGCACCCAGG - Intergenic
1067660352 10:48232769-48232791 GAAGAGACAGAGCTGGAGCAAGG + Intronic
1068633565 10:59323347-59323369 CTGGAGACAGCCCTGGATCCAGG - Intronic
1069246888 10:66217959-66217981 TAGGGGAAGGAGCTGGAGCCAGG + Intronic
1069359661 10:67627184-67627206 CAGGAGGCAGAGCTGGACCAGGG - Intronic
1069531857 10:69225594-69225616 CACGAGACTGAGCTGGGTCCTGG + Intronic
1069576945 10:69537507-69537529 CAGGAGAGAGGGCTGGAGCAAGG - Intergenic
1069799811 10:71075110-71075132 GAGGTGGCAGAGCTGGGGCCGGG + Intergenic
1069906369 10:71734842-71734864 CAGAGGACAGAGTTGGAGGCAGG - Intronic
1070343861 10:75523001-75523023 GAGGAGGCAAAGCTGGGGCCAGG - Intronic
1070565241 10:77599000-77599022 TAGGAGGCTGAGCTGGGGCCTGG - Intronic
1070579838 10:77711008-77711030 CAGAAGACAGAGCGAGAACCCGG - Intergenic
1070606241 10:77900461-77900483 CAGGAGACAGACCTTCACCCCGG + Intronic
1070727521 10:78802514-78802536 AAGGCAACAGAGCTGGAGCTGGG - Intergenic
1071674719 10:87644676-87644698 CAGGAAAGAGAGCTTGAGCAGGG - Intergenic
1071956887 10:90770178-90770200 AAGGAGGCAGAGCTGGGCCCAGG + Intronic
1072350994 10:94556922-94556944 CAGGAAACACATCTGGAGACAGG - Intronic
1072758569 10:98037460-98037482 TAAAAGGCAGAGCTGGAGCCGGG + Intergenic
1072930763 10:99659755-99659777 GAGCAGACGGAGCGGGAGCCTGG + Intronic
1073064183 10:100748701-100748723 CGGGAGCCCGCGCTGGAGCCGGG + Intronic
1073106940 10:101037485-101037507 CTGGAGAGAGAGTTGGGGCCTGG - Intronic
1073150866 10:101310587-101310609 CAGGAACCAGAGAGGGAGCCGGG - Intergenic
1073491336 10:103855319-103855341 CTGGAGAAGGAGCCGGAGCCCGG - Exonic
1073843915 10:107530490-107530512 CAGGAGAAAGTGGTGGAGTCAGG + Intergenic
1074311530 10:112327110-112327132 CAGGAAGCAAAGATGGAGCCAGG + Intergenic
1074910663 10:117905687-117905709 CTGCAGACAGAGCTCAAGCCTGG + Intergenic
1075002747 10:118810044-118810066 CAGATGTCAGGGCTGGAGCCAGG + Intergenic
1075041961 10:119115183-119115205 CAGGAGGTAGAACTGGAGTCTGG - Intronic
1075257796 10:120939263-120939285 CAGGACACAGGGCTGGAACGTGG + Intergenic
1075655157 10:124156416-124156438 GAGAAGAAAAAGCTGGAGCCAGG + Intergenic
1075917811 10:126184681-126184703 CAAGAGACAGAACTGAAGCGTGG - Intronic
1076047245 10:127304141-127304163 CAGGGGGCAGAGCTCCAGCCAGG + Intronic
1076484518 10:130807457-130807479 CAGGGGACAGAGCTTCAGCCTGG + Intergenic
1076595324 10:131621592-131621614 CAGGAGACAGGGACGGTGCCAGG - Intergenic
1076799103 10:132812466-132812488 CAGGAGTCAGTGCTGGGCCCAGG - Intronic
1076851386 10:133095150-133095172 CAGGAGCCCCAGCTGGAGCTCGG + Intronic
1077076199 11:703297-703319 CAGGAGTGGGAGCAGGAGCCAGG + Exonic
1077360577 11:2138765-2138787 CGGGAGAAAGAGCGGGGGCCGGG + Intronic
1077478508 11:2802295-2802317 CTGGCGACAGGGCCGGAGCCAGG - Intronic
1077495517 11:2884919-2884941 CCGGAGCCGGAGCCGGAGCCGGG + Exonic
1077511320 11:2965130-2965152 GAGGAGAAAGAGCAGAAGCCTGG + Intronic
1077524843 11:3057765-3057787 CAGGAGGCCGACCTGGAGCAGGG + Intergenic
1077645312 11:3918440-3918462 CAGGAGACTGAGCTTGAGCCTGG + Intronic
1077917690 11:6621995-6622017 CAGCAAACACAGCTGCAGCCCGG - Exonic
1077921023 11:6641708-6641730 AGGGAGCCTGAGCTGGAGCCAGG - Exonic
1078248934 11:9601394-9601416 GCAGAGACAGAGCTGGAGGCTGG + Intergenic
1078375877 11:10792674-10792696 CAGGAGGCTGAGCTGGACCCAGG - Intergenic
1078609981 11:12811606-12811628 CAGGAGTCAGGGCTGGAGAGGGG + Intronic
1078643148 11:13114504-13114526 CCTGAAACAGAGCTGGGGCCAGG - Intergenic
1078779436 11:14423036-14423058 GAGGAGAGAGAGCTGGAGGGAGG - Intergenic
1079006254 11:16793422-16793444 CAGGGCCCAGAGCTGGACCCAGG - Intronic
1079301744 11:19284604-19284626 CAGGAGACAGTGCTGGAAACTGG + Intergenic
1079355962 11:19730490-19730512 GAGGTGACAGGGCTGGGGCCGGG + Intronic
1079733909 11:23971469-23971491 CATGCCACATAGCTGGAGCCAGG - Intergenic
1080614750 11:33936098-33936120 CAGGAGGCAGAGCTGCTGCAGGG - Intergenic
1080615837 11:33944029-33944051 AAGGAGACTGAGATGGAGACAGG - Intergenic
1081867181 11:46366417-46366439 CAGGAGGCAGCCCTGGAGCTGGG - Exonic
1083367551 11:62150604-62150626 CAGAACACCAAGCTGGAGCCTGG + Intronic
1083899855 11:65638320-65638342 CTCGGGACTGAGCTGGAGCCCGG - Intronic
1084392488 11:68887147-68887169 CAGGAGGCAGAGCTGGGCCAGGG + Intergenic
1084404635 11:68964125-68964147 CATCAGACATAGCTGGATCCTGG - Intergenic
1084910082 11:72381388-72381410 TAGGAAGCAGATCTGGAGCCTGG - Intronic
1085386360 11:76160451-76160473 CTGGAGAGAGACCTGGGGCCCGG + Intergenic
1086341044 11:85848795-85848817 CAGGACAGTAAGCTGGAGCCAGG - Intergenic
1087576524 11:99996793-99996815 CAGGAGAGAGAGAGGGAGCATGG + Intronic
1088186624 11:107177653-107177675 CAGGGAACAAAGCTGGGGCCTGG - Intergenic
1088494691 11:110421231-110421253 CAGGAAACAGAGCTGTTGCAGGG - Intergenic
1088726879 11:112646594-112646616 CAGGAGATATTGCTGCAGCCAGG + Intergenic
1089046321 11:115504308-115504330 CAGAAGCCGGAGCCGGAGCCCGG + Exonic
1089083534 11:115797746-115797768 GTGGAGACAAAGCTGGAGGCAGG + Intergenic
1089101412 11:115965736-115965758 CAGTAGGTAGAACTGGAGCCCGG + Intergenic
1089412988 11:118262747-118262769 CAAGTGACAGAGCTGCAGACAGG - Intronic
1089461815 11:118658298-118658320 CAGGAGGCTGAGCAGGAGGCTGG + Exonic
1089578796 11:119468590-119468612 CAGGAGCCAGGGCTGGAGTCAGG + Intergenic
1089586501 11:119512917-119512939 CAGGAGGCAGAGCTGTTGCCGGG + Intergenic
1089605225 11:119637854-119637876 CAGGGTACAGAGCTGGAGGTGGG + Intronic
1089627020 11:119757752-119757774 AAAGAGACACAGCTGGAGCTGGG - Intergenic
1089638659 11:119832750-119832772 GTGGAGACAGGGCTGAAGCCTGG + Intergenic
1089693077 11:120198665-120198687 CAGGAGACAGAGCAGTAGGGTGG + Intergenic
1089784834 11:120900578-120900600 GAGGAAAAAGAGCTGGAGCCGGG + Intronic
1089940810 11:122414847-122414869 CAGGAGGCATAGCTGGACCTGGG + Intergenic
1090187735 11:124749259-124749281 CTGGAGAGAGAACTGGATCCAGG + Intronic
1090846199 11:130532120-130532142 AAGGAGACAGAGCCGGAGGCAGG - Intergenic
1091198753 11:133754201-133754223 CAGGAGAGAGCCCTGGACCCTGG - Intergenic
1091394159 12:143326-143348 TAGGAGAAATAGCTGGACCCGGG + Intronic
1091403019 12:192393-192415 CAGGACACACAACTGGGGCCAGG - Intronic
1091602826 12:1928357-1928379 CAGGAGCCAGGGCTGCTGCCCGG + Intergenic
1092091288 12:5805656-5805678 CAGGAAACAGAGATGGGGCTCGG - Intronic
1092152794 12:6262549-6262571 CAGGACACCCAGCGGGAGCCTGG + Intergenic
1092317872 12:7439070-7439092 CAGGACACAGGGCTGGAGCATGG - Intronic
1092770734 12:11894231-11894253 CAGGAGACAAATCTGAAGTCAGG + Exonic
1093097002 12:14983245-14983267 CAGGAGAGAAAGCAGGTGCCTGG - Intergenic
1094355381 12:29572507-29572529 CCAGAGACACAGCTGGAGTCTGG + Intronic
1094713400 12:32987193-32987215 CAGGAAACAAAGCTGGGGCCTGG - Intergenic
1095534275 12:43227660-43227682 CAGGAAACAGAGATGGATACGGG + Intergenic
1095634069 12:44410678-44410700 CAGGAGACTGATCAGGAGACTGG + Intergenic
1095751158 12:45712805-45712827 CAGGTGACAGAGCAAGACCCTGG - Intergenic
1095946178 12:47754892-47754914 CAGGCCACAGTGCTGGTGCCAGG - Intronic
1095958510 12:47819661-47819683 CCGGAGCCGGAGCCGGAGCCGGG + Intronic
1095988195 12:48014806-48014828 CAGGAGGCAGAGCTGGGACTGGG - Intergenic
1096210400 12:49760930-49760952 CAGGAGAAACACCTGAAGCCGGG - Intronic
1096547322 12:52349295-52349317 CAGAAGACAGAGATTAAGCCAGG - Intergenic
1096741764 12:53698653-53698675 CAGAAGACAGAGATGAGGCCAGG - Intergenic
1096868999 12:54581878-54581900 GAGGGGAAAGAGTTGGAGCCTGG - Intronic
1097053273 12:56236285-56236307 CAGGTGCCAGAGGTGGAACCAGG + Intronic
1097198446 12:57258074-57258096 CAGGAGAGGGTGCTGGAGACTGG + Exonic
1101011420 12:100454226-100454248 CAGGGCCCATAGCTGGAGCCTGG - Intergenic
1101692434 12:107094073-107094095 CAGGAGCCAGTGGTGGAGTCGGG + Intergenic
1102229898 12:111255422-111255444 CAGCAGACACACCTGGAGGCAGG + Intronic
1102250707 12:111385522-111385544 CAGCAGAAAGAGCTGGAGAAAGG + Intergenic
1102450276 12:113036954-113036976 TAGGAGACAGACCTGGAGGTGGG - Intergenic
1102589310 12:113945621-113945643 GAGAAGCCAGGGCTGGAGCCTGG + Intronic
1102705409 12:114876172-114876194 CCTGAGGCAGAGATGGAGCCGGG + Intergenic
1103217251 12:119211494-119211516 CAGGGAACAGTGCTGGACCCAGG + Intronic
1103386035 12:120533507-120533529 CAGGAGACAGAGGCGGAAACAGG - Intronic
1103480773 12:121248547-121248569 CAGGAGCCTGAGGTGGGGCCTGG - Intronic
1103555920 12:121766433-121766455 CAGAACAGGGAGCTGGAGCCGGG - Intronic
1103598984 12:122042132-122042154 CTGGGGGCAGAGCTGGGGCCCGG - Intronic
1104215064 12:126726696-126726718 CAGGGGACGGTCCTGGAGCCCGG + Intergenic
1104579048 12:129996226-129996248 CAGATGCCAGAGCTGGAGTCTGG + Intergenic
1104846123 12:131847870-131847892 CAGGGGACAGAGGGGGAGCAGGG - Intronic
1105419769 13:20241760-20241782 CAGGAGTCAAAGGTGGTGCCAGG - Intergenic
1105758802 13:23494416-23494438 CAGCAGACAGGGCTGGAGAAAGG - Intergenic
1106168467 13:27269674-27269696 CAGGACACAGAGCTATAGACTGG - Intergenic
1106393020 13:29354067-29354089 CAGGGGACTCAGGTGGAGCCTGG - Intronic
1106433990 13:29707992-29708014 TTGCAGACAGAGGTGGAGCCGGG - Intergenic
1107086310 13:36431475-36431497 CGGGCGACAGAGCTGGGGCTTGG - Intergenic
1107255745 13:38424955-38424977 CAGGAGGCAAAGCTGGGGCAGGG + Intergenic
1107360334 13:39610865-39610887 AAGGAGACAGAGATGGAGAGAGG + Intergenic
1107432516 13:40352614-40352636 CTGGTGACAAAGCAGGAGCCTGG - Intergenic
1107560224 13:41551481-41551503 GAGGACACAGAGAAGGAGCCAGG - Intergenic
1108525272 13:51280843-51280865 CAGGAGACAGACGTGGACACAGG + Exonic
1108956545 13:56165884-56165906 CAGGAGAAAGAGATGGAGTGGGG + Intergenic
1112109242 13:96276251-96276273 CAGAAGACAGGGCTGGAGGGAGG - Intronic
1112493270 13:99885619-99885641 CAGGAGCCAGCTTTGGAGCCGGG + Intronic
1112591519 13:100767541-100767563 CAGGAGAAAGAACTGTAACCTGG + Intergenic
1112733730 13:102394843-102394865 CTGGAGGCAGAGCTGCAGCGTGG + Intronic
1112793307 13:103027840-103027862 CAACAGACCCAGCTGGAGCCTGG - Intergenic
1112903230 13:104385651-104385673 TAGGAGACAGAGCAAGACCCTGG - Intergenic
1113090224 13:106610230-106610252 CAGGAGACAGAAGTGCAACCGGG - Intergenic
1113317586 13:109199252-109199274 CAGGGCACAGAGATGGAGCGAGG - Intronic
1113518966 13:110924766-110924788 CAGCAGACAGAGCTGGGTCCAGG - Intergenic
1113698916 13:112368493-112368515 CAGAAGACAGAACTGGAGATGGG + Intergenic
1113811381 13:113144466-113144488 CAGGAGACAAGGCTAAAGCCAGG + Intronic
1113884599 13:113651986-113652008 CAGGAGGCAGAGCTGGGGCGGGG + Intronic
1114455680 14:22851850-22851872 CAGGGGACAAAACTGGAGCCAGG - Intergenic
1115491881 14:33965694-33965716 CAGGACTCAGAGCTCGAGCAGGG - Intronic
1116326851 14:43540989-43541011 CCAGAGCCAAAGCTGGAGCCCGG + Intergenic
1118167667 14:63353818-63353840 GTGGAGAGAGAGCAGGAGCCAGG - Intergenic
1118645588 14:67835760-67835782 CAGGAGGCTGACCTTGAGCCAGG + Intronic
1119766824 14:77195717-77195739 GAAGTGACAGAGCTGGTGCCTGG + Intronic
1120297607 14:82663825-82663847 CAGGAGAAATCGCTGGAACCTGG - Intergenic
1121085382 14:91142176-91142198 CAGGTGGTAGAGCTGGAGCTTGG + Intronic
1121109604 14:91303446-91303468 CTGGGGAGAGAGGTGGAGCCTGG - Intronic
1121699289 14:95940141-95940163 CAGGAGACAGGTCTGAAGGCGGG - Intergenic
1121846533 14:97177154-97177176 GAGGAGACAGAGCTGCAGAGGGG - Intergenic
1122111114 14:99503196-99503218 CAGGCAGCAGGGCTGGAGCCGGG - Exonic
1122133778 14:99620856-99620878 CAGGAGTCAGACCTGGAGGCCGG + Intergenic
1122366520 14:101197854-101197876 CAGGAGAAAGCGCTGCACCCAGG - Intergenic
1122390700 14:101380675-101380697 CAAGAGACAGGGCAGGGGCCAGG + Intergenic
1122650238 14:103221925-103221947 CAACAGCCAGAGCTGGAGACCGG - Intergenic
1122748033 14:103911228-103911250 CGTGACACAGGGCTGGAGCCTGG + Intergenic
1122801345 14:104231183-104231205 CAGGACTGGGAGCTGGAGCCTGG + Intergenic
1122860351 14:104579732-104579754 CAGCAGAGAGGGCTGGAGACGGG + Intronic
1122889793 14:104726962-104726984 CAGCAGGCAGAGCCAGAGCCTGG - Intronic
1122935810 14:104955584-104955606 CTGAAGACAGAGGTGGAGGCAGG - Exonic
1123049482 14:105533921-105533943 GGTGAGACAGAGCTGGAGGCTGG - Intergenic
1123108891 14:105856094-105856116 CAGGAGAAAGTGATGGAGTCGGG + Intergenic
1123415842 15:20094593-20094615 TAAGAGACAGAGCTAGAGGCTGG - Intergenic
1123450910 15:20358328-20358350 GAGGGGACAGAGCTGGAGCCAGG - Intergenic
1123525182 15:21101707-21101729 TAAGAGACAGAGCTAGAGGCTGG - Intergenic
1124629262 15:31327603-31327625 CTGGAGCCCGAGCGGGAGCCGGG + Exonic
1125605929 15:40939885-40939907 CAGGAGACAGGGCAGGAGGGAGG + Intergenic
1125688772 15:41579643-41579665 TAAGAGACAAAGCTGGGGCCAGG - Exonic
1126378745 15:48023832-48023854 CAGGAGCCACAACTGGAGGCAGG + Intergenic
1127514237 15:59676261-59676283 GAGGAGAGAGAGCTTGAGCTTGG - Intronic
1128028612 15:64460697-64460719 CCGGAGCCGGAGCCGGAGCCGGG + Intergenic
1128331319 15:66757490-66757512 CTGGAGGCAGAGCTGAACCCAGG + Intronic
1128417454 15:67459661-67459683 CAGCAGACAGGGCAGGAGTCAGG - Intronic
1128792380 15:70442724-70442746 CGAGAAACAGAGCTGGAGTCCGG - Intergenic
1129195777 15:73965363-73965385 CTGGAGGCAGAGGGGGAGCCGGG - Intergenic
1129224150 15:74156684-74156706 CAGGAGACAGAGAAGGAAGCTGG + Intergenic
1129252354 15:74315973-74315995 CAGGAAACAGGGCAGGTGCCTGG - Intronic
1129312943 15:74725165-74725187 TAGGGGATGGAGCTGGAGCCTGG + Intronic
1129388404 15:75208208-75208230 CAGGGGATGGAGCTGGAGCAGGG - Exonic
1129596451 15:76967954-76967976 CAAGAGACACAGCTGTAACCTGG + Intergenic
1129731693 15:77936037-77936059 CAGGAGGCAGAGGTTGAGCAGGG + Intergenic
1129781585 15:78275542-78275564 CAGGAGCCTGAGCTGGAGCCTGG + Exonic
1130021142 15:80232878-80232900 CAGGAGCCAGAACCTGAGCCTGG - Intergenic
1131522483 15:93126900-93126922 CAGTGGACACAGCTGGAGCAGGG + Intergenic
1131541580 15:93279541-93279563 CAGGAGCCAAAGCTGGAGCCTGG + Intergenic
1132990611 16:2790920-2790942 AAGGACTCAGAGCTGGAGACCGG - Intergenic
1133143661 16:3767463-3767485 CAGAAGACAGCTCTGCAGCCTGG + Intronic
1133234172 16:4380167-4380189 CTGGTGACAGAGCTGGAGCTGGG - Intronic
1133315569 16:4881660-4881682 AAGGAGACAGAGCAGAGGCCGGG - Exonic
1133812370 16:9170503-9170525 CAGGGGACAGAGCTGGTCCTGGG + Intergenic
1133835329 16:9362595-9362617 CAAGAGACAGAGCTTGTGCAGGG + Intergenic
1133999580 16:10772264-10772286 AAGGTCACAGAGCTGGAGCGTGG + Intronic
1134066001 16:11228594-11228616 CAGGAGACAGACCTGGGTTCTGG + Intergenic
1134074833 16:11283308-11283330 GAGGAGACAGAGATGGGGGCGGG + Intronic
1134079856 16:11317206-11317228 CAGGAGACACAGCTGGAAGGAGG + Intronic
1134244900 16:12532748-12532770 CTGGGGACAGGGCAGGAGCCTGG + Intronic
1134322237 16:13174515-13174537 CTGGAGACAGAACTGGGGGCAGG + Intronic
1134370732 16:13621704-13621726 AAGGAGACAGACCTGGAGTGGGG + Intergenic
1134518763 16:14908062-14908084 CTGGAGGCAGAGCTGGAGACAGG - Intronic
1134555165 16:15158154-15158176 CTGGAGGCAGAGGTGGAGACAGG + Intergenic
1134706434 16:16306715-16306737 CTGGAGGCAGAGCTGGAGACAGG - Intergenic
1134797647 16:17056695-17056717 CTGGAGACAAGCCTGGAGCCTGG + Intergenic
1134825523 16:17281297-17281319 CAGGTACCAGAGCTGGAGGCAGG + Intronic
1134961106 16:18405395-18405417 CTGGAGGCAGAGCTGGAGACAGG + Intergenic
1134965408 16:18487998-18488020 CTGGAGGCAGAGCTGGAGACAGG + Intronic
1135048654 16:19174431-19174453 CAGGACCCACAGCTGGAGCCTGG + Intronic
1135075162 16:19386903-19386925 AAGTAGTCAGAGCTGGGGCCAGG - Intergenic
1135424361 16:22324969-22324991 CAGGAGCAAGAGCTGGGGCCTGG + Intronic
1135503232 16:23015005-23015027 CAGCAGACAGGGCTGGTGACAGG - Intergenic
1135600793 16:23781851-23781873 CAGAAAACAGAGTTGGGGCCAGG - Intergenic
1135667847 16:24351030-24351052 CAGGAGACAGAGCTGGCCCCTGG - Intronic
1135931024 16:26736825-26736847 CAGGAGACAGGTCTGAATCCAGG + Intergenic
1136028137 16:27483135-27483157 GAGGAGACAAAGCTGAAGTCTGG + Intronic
1136034194 16:27526376-27526398 TAGGAGACCAAGCTGGAGACTGG - Intronic
1136065452 16:27755323-27755345 CAGAAGGCAGAGATGGAGCAGGG - Intronic
1136522403 16:30805617-30805639 CCGGAGCCAAAGCTGGACCCAGG - Intergenic
1136618722 16:31413824-31413846 CTGGAGAATGAGCAGGAGCCAGG - Intronic
1137367800 16:47875830-47875852 CAGGTGACACAGCTGGTGACTGG + Intergenic
1137700413 16:50493921-50493943 CAGAAGCCAGGGATGGAGCCTGG + Intergenic
1138094283 16:54199951-54199973 CAGCTGACAGAGCAGGGGCCGGG + Intergenic
1138155150 16:54696159-54696181 CAGCAGACATAGCTGGGCCCTGG - Intergenic
1138386632 16:56639769-56639791 CTGGGGACAGAGCTTGGGCCAGG + Intronic
1138388016 16:56649333-56649355 CTGGAGGCAGGGCTTGAGCCAGG + Intronic
1138391186 16:56670809-56670831 CTGGAGTCTGAGCTTGAGCCAGG + Intronic
1138393044 16:56683867-56683889 CTGGAGGCAGGGCTCGAGCCAGG + Intronic
1138446931 16:57070440-57070462 CAGGGGACAGAGCAGGAGAGGGG + Intronic
1138531333 16:57635957-57635979 CACGAGGCAGAGCTGGGGCAGGG - Intronic
1138677881 16:58665243-58665265 CAGGAGAAGGAGCTGGAATCTGG - Exonic
1139038593 16:62977397-62977419 CAGGAGAGAGAGGAGGATCCAGG + Intergenic
1139160283 16:64497860-64497882 TAGTAGACAGAGCAGGAGCCTGG + Intergenic
1139550032 16:67667830-67667852 TGGGAGCCAGGGCTGGAGCCTGG + Intronic
1139599271 16:67976818-67976840 CTGGGGACAGGGCTGGTGCCAGG - Intronic
1139926682 16:70492078-70492100 AAGGCCACAAAGCTGGAGCCAGG + Intronic
1140650828 16:77086289-77086311 CAGGAGACAGAGTTGAAAGCTGG - Intergenic
1140710257 16:77670939-77670961 CAGAAAACAGACCTGCAGCCAGG + Intergenic
1141070763 16:80952595-80952617 CAGGAGACAGAGCAAAGGCCTGG + Intergenic
1141140754 16:81495410-81495432 CAGGAAACAGAGCGGCAGCCCGG - Intronic
1141146293 16:81532633-81532655 CAGGAGACCCACCTGGTGCCAGG + Intronic
1141251381 16:82362084-82362106 CAGAAGGCAGAGATGGGGCCAGG - Intergenic
1141388990 16:83648763-83648785 CAGGAGACAGAGATGGGGAGAGG - Intronic
1141421171 16:83917511-83917533 CAGAAGACAGAGAAGGGGCCTGG - Exonic
1141677039 16:85523517-85523539 AAGGAGCCAGGGCTGGGGCCAGG + Intergenic
1141710585 16:85696697-85696719 CAGGAGACTCACCTGGAGGCAGG + Intronic
1141746520 16:85929962-85929984 AAGGAGACAGAGCAGGAACGAGG - Intergenic
1141802302 16:86318333-86318355 CAGGAGACACAGTTGGAGATAGG - Intergenic
1142108295 16:88317999-88318021 CAGAGGACAGGGCTGGGGCCAGG - Intergenic
1142482255 17:226269-226291 CAGGTGACACAGCAGGCGCCAGG + Intronic
1142687674 17:1587137-1587159 GGGGAGGCAGAGCTGCAGCCAGG + Intronic
1142854261 17:2721268-2721290 CAGGACACAGAGCTGCAGGTGGG - Intergenic
1142860620 17:2758649-2758671 CAGGGGCCACAGCTGGAGCATGG - Intergenic
1143129999 17:4672026-4672048 GGGGAGGCAGAGCTGGAGGCAGG + Exonic
1143405931 17:6677260-6677282 CTGGAGAAAGAGCAGGAGCCAGG - Intergenic
1143527192 17:7479527-7479549 CCGGAGCCGGAGCTGGAGGCGGG - Intronic
1143680728 17:8474033-8474055 CAGGAACAAGAGTTGGAGCCAGG + Intronic
1144329712 17:14212658-14212680 CCTGTGACAGAGATGGAGCCCGG - Intergenic
1144495882 17:15744501-15744523 CAGTGGCCAGAGCTGCAGCCTGG - Intronic
1144595668 17:16568609-16568631 CAGGGCTCGGAGCTGGAGCCTGG - Intronic
1144666154 17:17103596-17103618 TAAGAGACAGAGCAGGGGCCTGG - Intronic
1144670066 17:17127891-17127913 CAGGAGCCAGTGCTGGGTCCCGG + Intronic
1145209001 17:20999463-20999485 CAGTGGCCAGAGCTGCAGCCTGG - Intergenic
1145897834 17:28470834-28470856 CTGGAGATAGAGCTGGGGCTGGG - Intronic
1146058996 17:29594665-29594687 CAAGAGCCAGAGCTGGGCCCGGG + Intronic
1146172065 17:30641978-30642000 GAGGAGACGGTGCTGGAACCCGG - Intergenic
1146214934 17:30971383-30971405 CTGGAGAGGGAACTGGAGCCCGG - Exonic
1146345523 17:32058014-32058036 AAGGAGACGGTGCTGGAACCCGG - Intergenic
1146837687 17:36125501-36125523 CAGGAAGCAGTGCTGGAGCCAGG - Intergenic
1146866316 17:36337903-36337925 CAGGAGAGCGAGTTGGACCCGGG - Intronic
1146972707 17:37085644-37085666 CAGGAGTCAGAGCCTCAGCCCGG - Exonic
1147015998 17:37491447-37491469 GATGAGTCAGAGCTGGAGGCAGG - Intronic
1147069186 17:37938515-37938537 CAGGAGAGCGAGTTGGACCCGGG - Intergenic
1147080714 17:38018052-38018074 CAGGAGAGCGAGTTGGACCCGGG - Intronic
1147096657 17:38142012-38142034 CAGGAGAGCGAGTTGGACCCGGG - Intergenic
1147317846 17:39629312-39629334 CAGGAGTCAAAGCTGGAGACTGG + Intronic
1147566517 17:41539540-41539562 CAGAAGAAAGGGCTGGAGCATGG + Intergenic
1147595724 17:41715912-41715934 CAGGGGACAGGGCTGGAGTGGGG - Exonic
1147760688 17:42795769-42795791 CAGAGGACAGTGCTGGAGGCGGG + Exonic
1148208620 17:45794853-45794875 CAGGAGGCAGAGCCGGGTCCTGG - Intronic
1148239726 17:45992362-45992384 CTGGAGACAGAGCAGCAGCCTGG + Intronic
1148498311 17:48068839-48068861 CAGGAGACATAAGTGGAGCTGGG - Intergenic
1149368782 17:55971855-55971877 GAGAAGAGAGAGCTGGAGCTGGG - Intergenic
1149993521 17:61395702-61395724 GAGGCGGCACAGCTGGAGCCCGG + Intergenic
1150576213 17:66433269-66433291 CCGGGGCCAGAGCTGGGGCCGGG - Intronic
1150646791 17:66983583-66983605 CATGAGTCAGACCTGGGGCCTGG - Intronic
1151009267 17:70474525-70474547 CAGGAGACAGAGAGAGAGCAAGG + Intergenic
1151306437 17:73265613-73265635 GGGGAGACAGAGGTGGAGACTGG + Intergenic
1151385023 17:73749954-73749976 CAGGAGAGTGACCAGGAGCCCGG - Intergenic
1151643559 17:75414213-75414235 CAGGTGACAGAAATGGGGCCAGG - Intergenic
1152072881 17:78142757-78142779 CAGGAGGCTGAGGTGGGGCCTGG - Exonic
1152085009 17:78212668-78212690 CAGGAGACAGAGAGAGAGCGGGG + Intergenic
1152120812 17:78417257-78417279 GAAGACACAAAGCTGGAGCCAGG + Intronic
1152337531 17:79707017-79707039 GAGGAGACAGAGCTGGAGCCAGG + Intergenic
1152430575 17:80246359-80246381 CAGGAGACTGAGCAGGGGCTGGG + Intronic
1152517001 17:80831254-80831276 GAGGAGGCAGTGCTGGGGCCTGG - Intronic
1152605901 17:81289909-81289931 CAGGAGACTGGGATGGAGCGGGG - Intronic
1152856488 17:82667605-82667627 CAGGAGACAGAGGAGGATGCGGG - Intronic
1152922303 17:83072245-83072267 CAGGAGTCAGGGCAGGAGGCTGG - Intergenic
1153595530 18:6721340-6721362 CTGGAGACAAAGCTGGAGACAGG - Intergenic
1153842022 18:9015906-9015928 GGAGAGCCAGAGCTGGAGCCAGG - Intergenic
1154156518 18:11948071-11948093 CTGCAGCCGGAGCTGGAGCCAGG + Intergenic
1154275469 18:12955936-12955958 CAGGAGGCTGAGGTGGGGCCAGG - Intronic
1154335254 18:13459955-13459977 CATGTGACAGGGCTGGAGCCAGG - Intronic
1154335262 18:13459993-13460015 CCAGTGACTGAGCTGGAGCCAGG + Intronic
1154412881 18:14150816-14150838 CAGGGGCCAGAGCAGGTGCCTGG + Intergenic
1155041427 18:22068472-22068494 AAGGAGACAAAGCTTGAGCAGGG + Intergenic
1155555863 18:27018831-27018853 CAGGAGAGAGAGCAGGAGAATGG + Intronic
1156449414 18:37258641-37258663 CAGGACAGAGAGCTGGAGAGAGG + Intronic
1156457113 18:37301058-37301080 CAGGAGACACAGGAGGAGGCAGG + Intronic
1156924849 18:42563856-42563878 CAGGAGACAGAGCAGGAAGAAGG + Intergenic
1157243593 18:46034114-46034136 CCGGAAACAGAGCTGTAGCCAGG + Intronic
1157666695 18:49493316-49493338 CAGGAGACAGATGTGGCGCTGGG - Intergenic
1158189768 18:54813568-54813590 CAGAAGGCAGAGCAGGAGCCAGG - Intronic
1158725502 18:59968224-59968246 CAAGAGACAGAGATGGAGGCAGG + Intergenic
1160031253 18:75261981-75262003 CAGGAGACAGGGGTTGTGCCTGG + Intronic
1160471030 18:79133892-79133914 CTGGAGTCAGAGCTGGAGCCAGG - Intronic
1160820140 19:1054080-1054102 CAGGAGACAGCGCTGGAGAACGG + Exonic
1161164747 19:2780344-2780366 CAGGAGACTGAGCTAGAACTCGG - Intronic
1161187368 19:2930315-2930337 TAGGAGATAGAGGTTGAGCCGGG + Intergenic
1161297289 19:3526452-3526474 GGGGAGGCAGAGCTGGTGCCTGG - Intronic
1161306860 19:3573387-3573409 CAGGAGCTAGGGCTGCAGCCGGG - Intronic
1161408043 19:4101358-4101380 GAGCAGTCAGAGCTGGAGCGAGG + Intronic
1161809626 19:6464521-6464543 CAGGAGAGACAACTGGCGCCAGG - Intronic
1161981837 19:7633977-7633999 AAGGAGACAGAGCTGGAGCTAGG - Intronic
1162087117 19:8255602-8255624 CAGGAGAGACAGCTGGGGCTGGG - Exonic
1162128716 19:8512678-8512700 CAGCAGCCAGGGCTGGAGCAAGG + Exonic
1162439534 19:10683871-10683893 CCGGAGACACTGCTGGACCCCGG + Intronic
1162888825 19:13717185-13717207 GAAGAGACAGAGCTGGACACCGG - Intergenic
1162990360 19:14298059-14298081 GAGGAGACGGTGCTGGAACCCGG + Intergenic
1163145824 19:15379050-15379072 CCGGGTACAGAGCTGGAGCCCGG + Intronic
1163469876 19:17489856-17489878 CAGGAAACAGGTATGGAGCCCGG + Intronic
1163638767 19:18450136-18450158 CTGCAGTCAGAGCTGGGGCCTGG + Intronic
1164339330 19:24372080-24372102 CAGGAGACAGGGTTTGAGACAGG - Intergenic
1164598135 19:29543599-29543621 CAGGACAAGGAGCTGAAGCCTGG + Intronic
1164648648 19:29876377-29876399 CAGGAGACACAGAAGGAGGCTGG - Intergenic
1164948792 19:32318674-32318696 GAGGTGACTGAGCTGGGGCCTGG + Intergenic
1165059448 19:33197970-33197992 CAGCAGACAGGGCTGGGGCTAGG - Intronic
1165093798 19:33399967-33399989 CAGGCGGCAGAGCTGGGGCTGGG + Intronic
1165184650 19:34007286-34007308 GATGAGACACAGCTGGAGCCTGG + Intergenic
1165287226 19:34852333-34852355 CAGGAGGCAGAGGCGGAGGCGGG - Intergenic
1165352701 19:35284814-35284836 CCCAGGACAGAGCTGGAGCCAGG + Exonic
1165435656 19:35793317-35793339 CAGGACACAGAGATGGAACCTGG - Intergenic
1165783960 19:38450149-38450171 CAGGGGACAGAGCCAGAGCAGGG + Intronic
1165943750 19:39428884-39428906 AAGGCGACAGAGCTGGGGCTGGG - Intergenic
1166139658 19:40799294-40799316 GAGGAGACTAAGCCGGAGCCGGG + Intronic
1166140152 19:40800996-40801018 CAGGAGGCAGAGCGGGAGGGTGG + Exonic
1166281014 19:41793330-41793352 TGGGAAACAAAGCTGGAGCCTGG - Intergenic
1166342340 19:42146222-42146244 CTGGAGACACAGATGGAACCAGG + Intronic
1166355424 19:42224689-42224711 CTGGAGCCGGAGCTGGTGCCGGG + Exonic
1166356202 19:42229058-42229080 CAGAAGACAGGGCTGGACCTGGG + Intergenic
1166499997 19:43333207-43333229 AAGGAGGTAGAGGTGGAGCCTGG - Intergenic
1166540995 19:43605781-43605803 AAGGTGACAGATCTGAAGCCGGG - Intronic
1166566748 19:43770198-43770220 GAGAAGACAGGGCTGGAGCTAGG - Intronic
1166585603 19:43945332-43945354 CAGAAGACAGAGCTGGAGAAGGG - Intergenic
1166726448 19:45031227-45031249 TAAGAGACAGAGCGAGAGCCTGG - Intronic
1166866172 19:45838745-45838767 CCAGAGGCAGAGCTGCAGCCTGG - Intronic
1166983880 19:46648678-46648700 CTGGAGGCAGAGCTGAAGGCAGG + Exonic
1167249165 19:48391526-48391548 CTGGCGGCGGAGCTGGAGCCGGG + Exonic
1167564797 19:50249463-50249485 CAGGGGACAGAGCCAGAGACAGG - Intronic
1168028061 19:53658019-53658041 CAGGGGAAAGGGCTGGAGCCAGG - Intergenic
1168146878 19:54424573-54424595 CAGGAGAAGGAGCTGAGGCCCGG - Intronic
1168317687 19:55491162-55491184 CAGGAGGCAGAGCTGGGAGCAGG - Intronic
925311799 2:2890009-2890031 CAGCAGAAAGAGCTGCAGACTGG + Intergenic
925422831 2:3725970-3725992 GAGGTGACAGAGCGGGACCCTGG + Intronic
925901784 2:8514069-8514091 CAGGAGACAGAGGGTGAGGCGGG + Intergenic
925905892 2:8539589-8539611 CAGGAGACTGCCCTGGACCCAGG + Intergenic
926008733 2:9392295-9392317 CAGGAGACAGGGCAGCATCCAGG - Intronic
926181771 2:10651120-10651142 CAGGAGGCAGGGCTGGAGGGTGG - Intronic
926834427 2:17001935-17001957 CACGAGAAAGAGCTGGAGATGGG + Intergenic
927463989 2:23323570-23323592 CAGGAGGCAGAGCTGGGTCGGGG + Intergenic
927562364 2:24083067-24083089 CATGTGGCAGAGCTGGGGCCTGG - Exonic
927653110 2:24924150-24924172 AGGGAAACAGAGCAGGAGCCTGG + Intergenic
927801178 2:26101322-26101344 TAGCAGCCACAGCTGGAGCCTGG + Intronic
928152550 2:28845107-28845129 CAGGTGACAGAGCAAGATCCTGG - Intronic
928320971 2:30282554-30282576 CAGGTGACAGAGATGGAGCAAGG + Intronic
928400466 2:30974474-30974496 CAGGAGTCAGAAGTGGTGCCAGG - Intronic
928711505 2:34011608-34011630 CAGGAGAAATAGCTTGAACCTGG + Intergenic
928950226 2:36807374-36807396 CAGGAGACAGAGGCGGTGCTGGG - Intronic
929002263 2:37359102-37359124 CAGGAGACAGAGATGCAGTTCGG - Intronic
929158603 2:38810289-38810311 CAGGGAACAAAGCTGGGGCCCGG + Intronic
929783973 2:44975949-44975971 CAGGAGAAAGAGCAGAAGCCGGG + Intergenic
929947389 2:46381416-46381438 AAGGAGACAGAGCTCGAGCTCGG + Intronic
930005362 2:46892230-46892252 CAGGTGCCCGAGCTGTAGCCTGG + Intergenic
930741396 2:54836130-54836152 CTGGAGACAGATTTGCAGCCAGG + Intronic
930772235 2:55140028-55140050 CAGGTGAAAGGGCTGGTGCCTGG + Intergenic
931839352 2:66132167-66132189 CAGGAGGCAGACCTGGAGCATGG + Intergenic
932435402 2:71700210-71700232 CAGGAGCCAGAGGTGGACCCGGG + Intergenic
932435807 2:71702063-71702085 AAGGAGGAAGAGCTGGGGCCAGG + Intergenic
932507904 2:72254317-72254339 GAGAAGACAGAGGTGGAGACTGG + Intronic
932589893 2:73059026-73059048 CTGGAGGCAGAGCTGGACCTTGG - Intronic
932764430 2:74460991-74461013 CAGCAGACAGTGCTGAGGCCTGG + Intergenic
933168271 2:79097751-79097773 CAGTAGACAGGGCAGGAGCTTGG + Intergenic
933688550 2:85161808-85161830 CAGGAGCCAGGGCTGGAAGCAGG + Intronic
933759844 2:85665724-85665746 CCAGAGCCAGAGCAGGAGCCAGG - Exonic
934747627 2:96769947-96769969 CAGCTGACAGAGCTGTGGCCAGG + Intronic
935462381 2:103353565-103353587 CAGTAGACAGTGCTGGACACGGG + Intergenic
935858554 2:107302138-107302160 GAGGAGACAAAGCAGGAGCCAGG - Intergenic
936234532 2:110732185-110732207 GAGGGGCCAGAGCTGGAGCCAGG + Intergenic
936402188 2:112173789-112173811 CAGGACACAGAGTGGGTGCCGGG + Intronic
936790563 2:116146032-116146054 AAGGAGACAGAATTGGAGCTAGG - Intergenic
936950929 2:117976806-117976828 CAGGAAGCAGAGGGGGAGCCTGG + Intronic
937167163 2:119830755-119830777 CAGGAGAGAGAGGGTGAGCCAGG - Intronic
937224924 2:120363247-120363269 CCTGAGGCAGAGCTGGAGGCAGG + Intergenic
937268043 2:120629686-120629708 CAGGAGAGGGAGCAGGACCCAGG - Intergenic
937385276 2:121425166-121425188 CAGGAGCCAGGGATGTAGCCGGG - Exonic
937427329 2:121811229-121811251 CAGGAGGCAGGGCCAGAGCCTGG - Intergenic
938342420 2:130544410-130544432 GAGGAGGCAGAGCTGGAGGCAGG + Intronic
938347412 2:130576299-130576321 GAGGAGGCAGAGCTGGAGGCAGG - Intronic
938582547 2:132660077-132660099 CTGGAGACAGTGCTAGAGGCGGG - Intronic
941361071 2:164551979-164552001 CAGAAGACAAAGCGGGAGCAGGG + Intronic
941394791 2:164961210-164961232 CAGGAGGCAAAGCAGGAGCAAGG + Intergenic
941659253 2:168178792-168178814 TAGGTCACAGAGCTGGATCCAGG - Intronic
942267670 2:174244715-174244737 CAGGAGAAACAGCTTGAGCCCGG - Intronic
942326295 2:174779548-174779570 CAGGAAACTGAGCTGGATCTGGG - Intergenic
942399005 2:175581328-175581350 CACCAGACACAGATGGAGCCAGG + Intergenic
944320762 2:198339343-198339365 CAGGAAACAGAGCAAGTGCCAGG + Intronic
945304073 2:208241975-208241997 CAAGGTACAGAGGTGGAGCCTGG - Exonic
947742844 2:232492740-232492762 GAGGGGCCAGAGCTGGAGACAGG - Intergenic
948131127 2:235601299-235601321 AAGGAGAAAGAGATGGAGACAGG + Intronic
948212749 2:236207158-236207180 CAGGATGCAGAGCAGGACCCAGG + Intronic
948220959 2:236269525-236269547 CTGGGCACAGAGCAGGAGCCAGG - Intergenic
948262361 2:236613605-236613627 CTGGACACAGAGCTGGAGACAGG - Intergenic
948462515 2:238137200-238137222 CAGGGGAAAGAGCAGGAGCAGGG + Intergenic
948494607 2:238339321-238339343 AAGGTGACTGAGCTGGAGCAGGG + Intronic
948655805 2:239476089-239476111 CAAGAGAGAGAGCTTGAGACAGG + Intergenic
948672204 2:239575742-239575764 CAGGACACAGAGATGAAGGCTGG - Intergenic
948701520 2:239763611-239763633 CAGGTGACAGAGGTGGAGAGAGG + Intronic
948821730 2:240553258-240553280 GAGAAGACAGAGAGGGAGCCTGG - Intronic
948832212 2:240603654-240603676 CAGGGGAGATAGCTGGCGCCTGG - Intronic
948981526 2:241497149-241497171 CAGGAGCCCCACCTGGAGCCTGG - Intronic
1168769736 20:407901-407923 CAGGAGTCGGCGCCGGAGCCGGG - Intronic
1169191687 20:3662163-3662185 CTGGAGACAGAGAAGGTGCCTGG + Intronic
1170585196 20:17729190-17729212 GACAAGACAGAGCTAGAGCCAGG - Intronic
1170928199 20:20744943-20744965 CAAGAGAGAGAGGTGGTGCCAGG - Intergenic
1171415747 20:24979427-24979449 CAGGAGCCTGAGCTGGGCCCTGG + Intronic
1171453942 20:25256026-25256048 CAAAAGAAAGAGCTGGAGCCAGG - Intronic
1172222599 20:33283996-33284018 CAGAAGACAGAGCTGAACCCCGG - Intronic
1172336827 20:34123263-34123285 CTGTAGCCACAGCTGGAGCCTGG - Intergenic
1172528805 20:35616973-35616995 CAGAGGGCGGAGCTGGAGCCGGG + Intronic
1172614384 20:36274000-36274022 CAAGAGAGAGGTCTGGAGCCAGG + Intergenic
1172847193 20:37936714-37936736 GAGGTGGCAGAGCTGGAACCAGG - Intronic
1172883954 20:38219099-38219121 CACGAGTAAGTGCTGGAGCCAGG + Intronic
1174292941 20:49521800-49521822 CAGGAGAGAGGGCAGGAACCAGG + Intronic
1175443684 20:59006910-59006932 CAGGAGGCAGAGCGCGCGCCTGG + Intronic
1175547603 20:59788647-59788669 CATCAGAAAGAGCTGGAGCCAGG - Intronic
1175600515 20:60268866-60268888 TAGGAGGGAGGGCTGGAGCCAGG + Intergenic
1175783475 20:61697956-61697978 CAGAAGTCAGAGATGGAGCCAGG + Intronic
1175871609 20:62211917-62211939 CAGGAGACAGGGCTGCAGCCAGG - Intergenic
1175940775 20:62536599-62536621 CAGGATACAGGGCTGGAGCCAGG - Intergenic
1175994710 20:62806926-62806948 CACTAGACAGGGCTGGAGGCTGG + Intronic
1176034783 20:63030926-63030948 CAAGAGTCAGTGCTGGGGCCGGG + Intergenic
1176423551 21:6534003-6534025 CTGGAGGCAGACCTGGAGGCAGG + Intergenic
1176860128 21:14007438-14007460 CAGGGGCCAGAGCAGGTGCCTGG - Intergenic
1176887911 21:14278008-14278030 CATGTGACTGAGCTGGAGCTAGG - Intergenic
1177045165 21:16160135-16160157 CAGCAGACAGAGCACCAGCCAGG + Intergenic
1177646760 21:23908720-23908742 AAGGAGACAGACCTGGAACTGGG + Intergenic
1177830824 21:26137044-26137066 CAGGAGGCGGAGGTGGAGGCGGG - Intronic
1177874515 21:26615007-26615029 AAGAAGAGAGAGCTGAAGCCTGG + Intergenic
1178408635 21:32346534-32346556 CAGAAGAGAGAGCTGAACCCAGG + Intronic
1179584318 21:42365256-42365278 CAGGGGGCAGAGCTGGGGGCTGG + Intronic
1179699045 21:43142319-43142341 CTGGAGGCAGACCTGGAGGCAGG + Intergenic
1179910188 21:44443340-44443362 CAGGAGAGGGAGCTGGAGAGGGG - Intergenic
1180010930 21:45050707-45050729 CAGGGGACGGGGCGGGAGCCAGG + Intergenic
1180024176 21:45149243-45149265 CAGAGGACAGAGCTGGTGTCAGG - Intronic
1180036573 21:45253375-45253397 CAGCTGTCAGAGCAGGAGCCTGG - Intergenic
1180049791 21:45325886-45325908 GAGGAGACAGAGGTCCAGCCAGG - Intergenic
1180143775 21:45908757-45908779 CAGGAGACAGAGCTGGGCTTTGG - Intronic
1180730113 22:17974956-17974978 TAGAAGACAGAGCTGGGCCCAGG + Intronic
1180831483 22:18909193-18909215 CTGTAGGCACAGCTGGAGCCAGG + Intronic
1181414040 22:22746562-22746584 CAGGACACTGAGCAGGGGCCTGG + Intronic
1181443296 22:22949710-22949732 CAGGAGACAGAGCAGGGACCTGG - Intergenic
1181855327 22:25777460-25777482 CTGGAGGCAGATCTGGAGGCAGG + Intronic
1181863496 22:25837329-25837351 CAGGAGACTGAGGTGTGGCCAGG + Intronic
1182112701 22:27734617-27734639 GAGGGGACAGTGCTGGGGCCAGG - Intergenic
1182294542 22:29305373-29305395 GAGAAGACAGGGATGGAGCCGGG - Intergenic
1182543846 22:31061381-31061403 TAAGAGACAGAGCTAGAGACCGG + Intergenic
1182692764 22:32175574-32175596 TAGGAGAAAGGGCAGGAGCCAGG - Intergenic
1182844915 22:33422475-33422497 CAGGAGACAGAGAACGAGCTTGG + Intronic
1183206753 22:36424759-36424781 GAGGAGAGAGTGCTGGAGCAGGG - Intergenic
1183315314 22:37133796-37133818 CAGGAGGCTGAACTTGAGCCTGG - Intronic
1183410238 22:37650657-37650679 CTGGAGCCGGAGCCGGAGCCGGG - Exonic
1183452904 22:37906386-37906408 CCGAAGCCAGAGCCGGAGCCGGG + Exonic
1183464803 22:37974141-37974163 CCGAAGACAGAGCTGCAGTCGGG - Exonic
1183493177 22:38127508-38127530 GGGGAGAGAGAGGTGGAGCCAGG + Intronic
1183714938 22:39528112-39528134 CCGGGGGCAGAGCTGGAGTCAGG - Intergenic
1183765204 22:39866974-39866996 CAGGAGGCAGAGCTGGCGGTGGG - Intronic
1183808171 22:40230381-40230403 CAGGAGAAATTGCTTGAGCCTGG - Intronic
1184287978 22:43482759-43482781 CATGGGACAGAGCTGCAGCCAGG + Intronic
1184390965 22:44203044-44203066 CATGAGATAGCTCTGGAGCCAGG + Intronic
1184465886 22:44668736-44668758 CCGGAGCCGGAGCCGGAGCCCGG - Intronic
1184478827 22:44735771-44735793 GAGGGGACAGAGCTGGGGCAAGG + Intronic
1184615724 22:45637020-45637042 CAGAAGACAGAGGTGGAGCAGGG - Intergenic
1184636494 22:45836401-45836423 CAGGAGACAGGGAGGGGGCCAGG - Intronic
1184743448 22:46442492-46442514 CAGGAGCCACAGCTGGGGGCAGG - Intronic
1185051725 22:48557567-48557589 CAGGAGGCTGAGTGGGAGCCTGG + Intronic
1185119137 22:48955356-48955378 CAGGAGACCCACCTGGAGCCTGG - Intergenic
1185161288 22:49231425-49231447 AAGGAGACAGAGGAAGAGCCAGG - Intergenic
1185244631 22:49766332-49766354 CAGGAGCCAGAGTGGGAGGCTGG + Intergenic
1185305765 22:50115170-50115192 CAGATGACAGAGCCTGAGCCTGG + Exonic
1185324201 22:50217670-50217692 CAGGAGAGAGAGCTGCAGACAGG + Exonic
1185400002 22:50610780-50610802 CAGGAGACAGAGCGGTGGGCAGG - Exonic
1203281567 22_KI270734v1_random:134464-134486 CTGCAGGCACAGCTGGAGCCAGG + Intergenic
949435957 3:4029451-4029473 CAGAAGACAGAGCTTTAGCCAGG - Intronic
949496301 3:4635431-4635453 CAGGAGAAAGGGGTGGACCCGGG - Intronic
950172557 3:10849396-10849418 CAGGAGAAGGAGCTGGTGACAGG - Intronic
950369248 3:12514272-12514294 CAGGGGACAGAAGTGCAGCCAGG + Intronic
950406816 3:12810088-12810110 CAGCAGACAGTGCAGGAGGCTGG - Exonic
950462723 3:13134994-13135016 CAGGAGGCAGAGCTCGGGCCTGG + Intergenic
950720392 3:14878275-14878297 CATGAAACAGTGCTGGAGCTGGG + Intronic
951935213 3:28015059-28015081 CAGGAGACAGTGATCGATCCAGG - Intergenic
952062058 3:29522798-29522820 CAGGATACAGAGCATGAGACTGG + Intronic
952111090 3:30124583-30124605 CAGGAGAGAGAGATAGAGCGAGG + Intergenic
952611492 3:35215817-35215839 CCAGAGCCAAAGCTGGAGCCTGG + Intergenic
952701478 3:36332992-36333014 CAAGAGACAGAGCCAGAGCCAGG - Intergenic
953249007 3:41226144-41226166 CAGGAGGTAGAGCTCAAGCCAGG + Intronic
953470682 3:43163510-43163532 CAGGAAACAGTGCAGGAGCAGGG + Intergenic
953475969 3:43206115-43206137 CAGGAGACAGAAAGGGAGGCAGG + Intergenic
953506420 3:43490151-43490173 TAGGAGACAGGGCTACAGCCAGG + Intronic
953885081 3:46710453-46710475 CCGGAAAGAGAGCTGGAGTCTGG + Exonic
954137162 3:48587267-48587289 CGGGTGACAGGGCTAGAGCCTGG - Exonic
954330905 3:49889844-49889866 CAGGAGACAGAGCTCCTGCCTGG - Intronic
954560089 3:51549374-51549396 CAGGAGACAAATCCAGAGCCAGG + Intronic
954711132 3:52505608-52505630 CAGGACTCAGAGGTGGAGGCTGG + Intronic
954805849 3:53220018-53220040 CAGGAGGCACTGCTGCAGCCAGG + Intergenic
955193512 3:56784124-56784146 CAGAAGGCAGATGTGGAGCCAGG - Intronic
955246023 3:57225970-57225992 CAGGAGACTCAGTTGAAGCCGGG - Intronic
955345646 3:58159665-58159687 CACGTGTCTGAGCTGGAGCCAGG + Exonic
955536138 3:59925539-59925561 CAGGGGATAGACCTGGACCCTGG - Intronic
956642579 3:71428883-71428905 CAGGAGGCACTGCTGAAGCCGGG + Intronic
956663720 3:71622918-71622940 ATGGAGGCAGAGATGGAGCCAGG + Intergenic
959849619 3:111071612-111071634 GAGGAGACAGGGCTTGCGCCCGG + Intronic
960966661 3:123110386-123110408 GTGGTGGCAGAGCTGGAGCCTGG + Intronic
961026641 3:123564229-123564251 CAGTGGACAGGGCTGGAGTCTGG + Intronic
961432763 3:126894683-126894705 CAGCAGACGGAGCAGGAGGCTGG + Intronic
961465672 3:127079605-127079627 CAGGAGACATAGATGGAGAGTGG + Intergenic
961745115 3:129059625-129059647 GAGGAAGCAGAGCTGGGGCCTGG + Intergenic
961831743 3:129626728-129626750 CTGGGGACAGAGCTGGGGCGGGG + Intergenic
961888413 3:130111498-130111520 CAGGAGACCGGGCGGAAGCCGGG + Intronic
963253144 3:143120275-143120297 GAGGAGACGTCGCTGGAGCCGGG + Exonic
964524520 3:157603962-157603984 CAGGAGATGAAGCTGAAGCCCGG - Intronic
964726558 3:159819821-159819843 CAGGTGGCTGAGCTGGTGCCTGG + Intronic
965742919 3:171895425-171895447 GGGGAGACAGAGCTGGAGAGGGG - Intronic
966129520 3:176621662-176621684 CAGGAGCCAGAGCTGTAGAATGG + Intergenic
966194120 3:177297017-177297039 CAGGGAACAAGGCTGGAGCCTGG + Intergenic
967010740 3:185431028-185431050 CAGGAGACAGAGAAGGGGCAAGG + Intronic
967493686 3:190120616-190120638 CGGGAGCTGGAGCTGGAGCCCGG - Exonic
967548106 3:190756705-190756727 CAGGAGACAGAATTGTAGCTTGG + Intergenic
968058554 3:195711478-195711500 CAGGAGACTCACCAGGAGCCAGG - Intergenic
968075269 3:195812716-195812738 CAGGGCAGGGAGCTGGAGCCAGG + Intergenic
968315629 3:197722167-197722189 CAGGAGGCAAAGGTGGAGCTGGG + Intronic
968568816 4:1328771-1328793 CAGGAGCCGGAGCAGGACCCCGG - Intronic
968679321 4:1905768-1905790 ATGGAGACAGAGCTGAAGCCAGG - Intronic
968699397 4:2047471-2047493 CAGGAGACAGAGGCGGAGGTGGG + Intergenic
968890290 4:3365108-3365130 CAGGAGCCTGGGCTGGAGCCTGG + Intronic
969292891 4:6252060-6252082 CCGGAGTCAGTGGTGGAGCCAGG + Intergenic
969664641 4:8550025-8550047 CAGGAGACAGAGCAGGAAATGGG - Intergenic
969688267 4:8689077-8689099 CAGGGGCCAGCGCTGGAGGCAGG + Intergenic
969718020 4:8877755-8877777 CTGGAGACTGCCCTGGAGCCTGG + Intergenic
970423435 4:15926003-15926025 CAGGGCACCCAGCTGGAGCCAGG - Intergenic
970436093 4:16036978-16037000 AAGGAAAGAGAGCAGGAGCCAGG + Intronic
971267121 4:25105580-25105602 CAGGAGGCAGACAAGGAGCCGGG - Intergenic
971496707 4:27274447-27274469 CATGAAAGAGAGCTGGAGCAGGG + Intergenic
972522275 4:39870492-39870514 CAGGAGATATTGCTTGAGCCTGG + Intronic
973148267 4:46857120-46857142 AAGGGCACAGAACTGGAGCCTGG + Intronic
975246988 4:72130957-72130979 CAGGATAGAGAGCTGGAACGGGG + Intronic
976093381 4:81480370-81480392 AAAGAGACAGATCTGGAGCTAGG + Intronic
977035109 4:91940979-91941001 CATGAGACAAAGATGAAGCCTGG + Intergenic
978078901 4:104568127-104568149 CTGGAAACAGGGCTGAAGCCAGG - Intergenic
979218111 4:118190667-118190689 CAGGAGGCAAAGCTGGGGCAGGG + Intronic
979965998 4:127077317-127077339 CAGGAAAGGGGGCTGGAGCCAGG - Intergenic
980870576 4:138607038-138607060 CAGGAGAGCAGGCTGGAGCCAGG - Intergenic
981790042 4:148526346-148526368 CAGGGAACAAAGCTGGGGCCTGG + Intergenic
982972354 4:162005190-162005212 CAGGAAACAGAGCTGGAAGTTGG - Intronic
983556697 4:169065582-169065604 CAGGGGGCAGAGGTGGATCCAGG - Intergenic
983989576 4:174101347-174101369 TGGGAGCCAGAGCTAGAGCCTGG - Intergenic
984410446 4:179391053-179391075 CAGGAGACCGGGCTTAAGCCAGG - Intergenic
984688340 4:182696916-182696938 GAAGTGACAGAGCTGGAACCAGG - Intronic
984802876 4:183730899-183730921 CAGGAGACAGATCTGGACTTAGG + Intergenic
985096406 4:186416933-186416955 CAGGAGACAGAGAAGGAAGCTGG + Intergenic
985626298 5:990336-990358 CAGGGGACACAGCTCAAGCCTGG - Intergenic
985631700 5:1017399-1017421 CCCCAGACAGAGCTGGAGCAGGG + Intronic
985643672 5:1075126-1075148 CACGAGACAGAGCTCCAGGCTGG + Intronic
985956247 5:3268268-3268290 CAGGAGGCAGGGCTGGAGAGAGG - Intergenic
986004388 5:3656114-3656136 GAGGAGACAGAGCAGGGGCCTGG + Intergenic
986348632 5:6856954-6856976 CAAGACAGAGTGCTGGAGCCCGG - Intergenic
986559689 5:9048129-9048151 CAGCAGACAGTCCTGGACCCTGG + Intronic
986597313 5:9437159-9437181 CAGGAGACAAAACTGAAACCAGG + Intronic
986713216 5:10502731-10502753 TGGGAGGCAGAGGTGGAGCCAGG + Intergenic
987072780 5:14353612-14353634 GAGAAAACAGAGCTGGATCCAGG + Intronic
987768477 5:22267845-22267867 CAGAAAATAGAGCTGAAGCCTGG + Intronic
988056908 5:26108948-26108970 GAGGAGACAGAGCTGGAAGGAGG + Intergenic
989020754 5:37004426-37004448 CAGGGGACAGAGCAAGACCCTGG - Intronic
990591616 5:57271176-57271198 CTGGTGACACAGCAGGAGCCAGG + Intergenic
992551757 5:77866253-77866275 CAGGAGACGGAGCAGGAGTGGGG + Intronic
992760532 5:79947620-79947642 CAGGAGACAGTGCTGAAGATTGG - Intergenic
993176648 5:84494879-84494901 CAGGAGAGAGAGCAAGAGCAAGG + Intergenic
993870512 5:93248153-93248175 GAGGAAACAGAGCTGGAGACAGG - Intergenic
994766099 5:103920224-103920246 CAGGAGAATGAGGTGAAGCCAGG + Intergenic
994993451 5:107028899-107028921 CAGGAGGGAGAGGTGGAGCAGGG - Intergenic
995407988 5:111823396-111823418 CAGGAGACAGAGCTAGACTGGGG - Intronic
996142743 5:119932715-119932737 CAGCAGCCTTAGCTGGAGCCAGG - Intergenic
996221691 5:120940567-120940589 CAGGACATAGAGCTGGAGAGAGG + Intergenic
997024004 5:130036639-130036661 AAGGACTCACAGCTGGAGCCTGG - Intronic
997381274 5:133440145-133440167 CAGGAGAGAGCTCTGGAACCCGG + Intronic
997584005 5:135034150-135034172 CCGGAGCCGGAGCCGGAGCCGGG - Exonic
997585195 5:135039684-135039706 CCAGAGCCAGAGCTGGATCCGGG - Intronic
997601419 5:135141228-135141250 CTGGAGACCAAGGTGGAGCCAGG - Intronic
997657765 5:135568097-135568119 CAGGAAACAGGTCTGTAGCCGGG + Intergenic
998224365 5:140315099-140315121 CAGGAGACAAATTTGGAGTCAGG + Intergenic
998386140 5:141758148-141758170 TAGGGGAGTGAGCTGGAGCCTGG - Intergenic
999626042 5:153521341-153521363 TAAGAGGCAGAGCTGGAGTCAGG + Intronic
1000151307 5:158503895-158503917 CAGGGGAGAGAGCTGGAGGTAGG + Intergenic
1001421411 5:171590010-171590032 TAGGAGACAGGGGTGCAGCCAGG + Intergenic
1002196551 5:177504499-177504521 CAGGGGGCAGGGCTGGGGCCTGG + Exonic
1002201342 5:177530420-177530442 CAGGAGAGGGAGATGGAGGCAGG - Intronic
1002300686 5:178255852-178255874 GAGGAGACAGAGCCGAGGCCAGG + Intronic
1002418724 5:179134722-179134744 CTGGAGCTGGAGCTGGAGCCGGG - Intronic
1002418730 5:179134747-179134769 CGGGAGCTGGAGCTGGAGCCGGG - Intronic
1002487647 5:179550615-179550637 CTGGAGCCGGAGCTGGAGCCGGG + Exonic
1002841707 6:912070-912092 CAGGATGCAAAGCAGGAGCCCGG - Intergenic
1004026025 6:11819287-11819309 CAAGAGAAAGATCTGCAGCCTGG - Intergenic
1004105172 6:12660877-12660899 CAGGAGGGAGAACGGGAGCCAGG + Intergenic
1005009343 6:21321381-21321403 CAGGAGCCAGTGATGGAACCAGG - Intergenic
1005360013 6:25023103-25023125 CAGGGAACAAAGCTGGGGCCTGG + Intronic
1005442231 6:25882311-25882333 GAGCAGACGGCGCTGGAGCCCGG + Intergenic
1005824393 6:29623930-29623952 GTGGAGACAGAGCTGCAGCCAGG + Exonic
1006100124 6:31681369-31681391 CAGGGAACAGAGCTTGAGCGGGG - Intronic
1006424806 6:33957308-33957330 CAGGAGACAGAGCTTTAGCCAGG + Intergenic
1006997204 6:38272375-38272397 CAGTAGACAGAGCTGGCAACAGG - Intronic
1007164773 6:39821585-39821607 GAGGAGACAGAGGTGGGGACTGG + Intronic
1007423808 6:41734744-41734766 CAAGAGACCGAGCTGGAGGAAGG + Intronic
1008037876 6:46765114-46765136 CAGAGGACAGAGCTGGAACTTGG + Intergenic
1008466737 6:51839972-51839994 AAGAAGACAGAGCTGGGGCTTGG - Intronic
1008632978 6:53381703-53381725 CAGGAGAAAGACCTGGAGGTGGG - Intergenic
1008867294 6:56228104-56228126 CAGGAAACAGAGCAGGAACATGG + Intronic
1008870843 6:56270791-56270813 CAGGAGACAGAGCATGAGGGAGG - Intronic
1009028432 6:58027692-58027714 AAGGAGGCAGAGATGGAGTCAGG + Intergenic
1010132451 6:72510251-72510273 CAGGAGTTAGGACTGGAGCCAGG - Intergenic
1010771760 6:79839981-79840003 CAGGAGAGAGGGAGGGAGCCAGG + Intergenic
1010793551 6:80092670-80092692 CAGGAGAAATATCTTGAGCCCGG - Intergenic
1011670346 6:89677418-89677440 CAGGAGTCAGATCCTGAGCCAGG + Intronic
1011773445 6:90701304-90701326 AAGGAAACAGAGAGGGAGCCAGG + Intergenic
1011795384 6:90947294-90947316 GAGGAGGCAGAGCTGGGCCCAGG + Intergenic
1012471710 6:99579877-99579899 CAGGAGCAAGAGGTGGAGGCTGG - Intergenic
1015708482 6:136113830-136113852 CAGGAGACAGAGCTGTAGACGGG - Intronic
1016614523 6:146030001-146030023 ATGGCTACAGAGCTGGAGCCGGG - Exonic
1016622773 6:146131928-146131950 GAAGAGACAGAGCTGAAACCTGG + Intronic
1016939361 6:149471759-149471781 CAGGGGACAGAGCCACAGCCAGG + Intronic
1017159863 6:151354781-151354803 CAGGAGACAGAGGCAGAGGCAGG - Intronic
1017255264 6:152326327-152326349 CAGGAGCCAGAGGATGAGCCGGG - Exonic
1017738071 6:157381483-157381505 CAGGAGAGAGCGCTGGCGACTGG - Exonic
1018028807 6:159826122-159826144 CAGGAGCCGGCGCTGGGGCCGGG + Intergenic
1018394738 6:163369737-163369759 GAGGGGACAGAGCTGGACCGAGG - Intergenic
1018430443 6:163717586-163717608 CAGGAGGCAGGGCTGAAGGCAGG - Intergenic
1018631352 6:165825689-165825711 CAGGAGCCATGGCTGGAGTCAGG - Intronic
1019008874 6:168825813-168825835 CACGAGGCAGGGATGGAGCCTGG + Intergenic
1019058088 6:169237092-169237114 GAGCAGCCACAGCTGGAGCCGGG - Intronic
1019168742 6:170116843-170116865 CAGGAGGAAGAGCAGGAGGCTGG + Intergenic
1019388928 7:774393-774415 CAGGCGGGAGAGCGGGAGCCAGG + Intronic
1019401620 7:857266-857288 CAGGTGTGAGAGCTGGAGCACGG + Intronic
1019618870 7:1979847-1979869 CAGGGGGCGGCGCTGGAGCCGGG - Intronic
1019923946 7:4180201-4180223 CTGGGCATAGAGCTGGAGCCGGG - Intronic
1019923957 7:4180251-4180273 CTGGGCATAGAGCTGGAGCCGGG - Intronic
1019923963 7:4180276-4180298 CAGGGCATAGAGCTAGAGCCGGG - Intronic
1019923968 7:4180301-4180323 CTGGGCATAGAGCTGGAGCCAGG - Intronic
1019923973 7:4180326-4180348 CTGGGCATAGAGCTGGAGCCGGG - Intronic
1019923979 7:4180351-4180373 CTGGGCATAGAGCTGGAGCCGGG - Intronic
1019923985 7:4180376-4180398 CTGGGCATAGAGCTGGAGCCAGG - Intronic
1019923990 7:4180401-4180423 CTGGGCATAGAGCTGGAGCCAGG - Intronic
1019924000 7:4180451-4180473 CAGGGCATAGAGCTGGAGCCGGG - Intronic
1019924006 7:4180476-4180498 CTGGGCATAGAGCTGGAGCCAGG - Intronic
1019924011 7:4180501-4180523 CTGGACATAGAGCTGGAGCCAGG - Intronic
1019924015 7:4180526-4180548 CTGGGCATAGAGCTGGAGCCGGG - Intronic
1019934121 7:4243156-4243178 CAGAAGACAGAGTTGCAGCAAGG - Intronic
1020206785 7:6123966-6123988 CAGGAGGCAGAGTTGAACCCAGG - Intronic
1020310856 7:6867457-6867479 GGGGAGTCAGAGCTGAAGCCAGG + Intergenic
1020383967 7:7577464-7577486 GAGGAGACAAATCTGGAGCCGGG + Intronic
1021665948 7:22980082-22980104 CAAGGGTCAGACCTGGAGCCAGG + Intronic
1021742081 7:23696970-23696992 CAGGGGGCAGAGCTGGAGGTGGG + Intronic
1022175765 7:27870328-27870350 CAGGTAGCAGAGCCGGAGCCAGG - Intronic
1023048043 7:36228596-36228618 CTGCAGACACAGCTGGGGCCAGG + Intronic
1023181775 7:37492111-37492133 CCAGAGCCAGAGCTAGAGCCAGG + Intergenic
1023344852 7:39261094-39261116 CAGGAGACAGATCTGTGGCGTGG - Intronic
1024394310 7:48848239-48848261 CAGGAGCCAGAGGAGGGGCCTGG + Intergenic
1024400956 7:48924406-48924428 CAGGAGCCAGAGGAGGGGCCTGG - Intergenic
1024536358 7:50437844-50437866 CAGCAGACAGAGCTAGAGTGAGG - Intergenic
1024924476 7:54598760-54598782 CTGCAGAGAGGGCTGGAGCCTGG - Intergenic
1026023777 7:66729685-66729707 CAGGAGACCCACCTGGAGACTGG - Intronic
1026888406 7:73967947-73967969 CAGGAGACCCACCTGGAGGCTGG - Intergenic
1026983063 7:74537890-74537912 CAGGAGAGTGAGCAGGTGCCTGG + Intronic
1027446605 7:78280671-78280693 CAGGAGTAAGTGGTGGAGCCAGG + Intronic
1028643927 7:93074263-93074285 CAGGAGACTGAGGTGGAGAATGG - Intergenic
1028876066 7:95824757-95824779 CAGGACACAGACCTGCAACCCGG + Intronic
1029281583 7:99439037-99439059 CAGGAGACCGAGGGGGAGCCGGG + Intronic
1029347054 7:99986328-99986350 TAAGAGGCAGAGCTGCAGCCAGG + Intergenic
1029419157 7:100463469-100463491 GAGGAGACCGAGGTGGAGCTGGG - Exonic
1029540603 7:101180046-101180068 CCGGAGCCGGAGCTGGAGCCAGG + Exonic
1029882037 7:103824408-103824430 AAGGAGACTGAGCTGGAACTGGG - Intronic
1030068266 7:105677059-105677081 CAGGAGGCAGAGCAGGTGCCAGG + Intronic
1030734834 7:113035376-113035398 CAGGAGCCAGGACTGGAACCGGG + Intergenic
1031040773 7:116836462-116836484 TTGGAGTCAGAGCTGGAGCCAGG - Intronic
1032019640 7:128400216-128400238 CAGGTGAGAGAGAAGGAGCCAGG + Intronic
1032020488 7:128405082-128405104 CAGGAGGCAGAGCTAGTGCCAGG + Intronic
1032076580 7:128838864-128838886 CAGGAGGAAGAGCTGGGGCGGGG + Intronic
1032640452 7:133760561-133760583 CAAGAGAAAGAGCAGGTGCCAGG - Intronic
1032722636 7:134563235-134563257 CAGTGGGAAGAGCTGGAGCCTGG - Intronic
1033041222 7:137920116-137920138 GAGGAGGAAGACCTGGAGCCAGG - Intronic
1033194080 7:139311902-139311924 GTGGAGACAGAGCTGGATCTTGG - Intergenic
1033256565 7:139806653-139806675 CAGGAGACAGAGAGGGAGACAGG - Intronic
1034277140 7:149828939-149828961 GAGGAGATGGTGCTGGAGCCAGG + Intergenic
1034424457 7:151007287-151007309 CAGGAGTCAGAGCAGGGGCTGGG - Intronic
1034438613 7:151075571-151075593 CAGGAGAAAGAGTTGGCCCCGGG - Intronic
1034964914 7:155384881-155384903 CCGTAGACAGAGCAGGAGCCAGG - Intronic
1035004442 7:155644743-155644765 CAGGAGGCAGAGGCGAAGCCGGG - Exonic
1035082288 7:156226839-156226861 CAGGAGCCAGAGATGGTGCCAGG + Intergenic
1035757692 8:2046429-2046451 CAGGAGAGTCAGCTGGCGCCTGG + Intronic
1036217541 8:6893135-6893157 CAGGAGACTAAGGTGGGGCCTGG - Intergenic
1036427667 8:8661158-8661180 CAGGCGACATGGCTGCAGCCAGG + Intergenic
1036432289 8:8702253-8702275 CAGGAGCCCGACCCGGAGCCCGG + Exonic
1036590141 8:10161696-10161718 CTGGGGTCAGAGCTGAAGCCAGG + Intronic
1036634362 8:10538738-10538760 CAGGGGACAGAGCAGGAGCCAGG - Exonic
1037226788 8:16602245-16602267 CAGCAGACGGATCGGGAGCCAGG - Intergenic
1037323324 8:17664506-17664528 CTGCAGGCAGAGCTGGAGGCAGG - Intronic
1037817780 8:22120876-22120898 CAGGAGAAAGCCCTGGGGCCGGG - Exonic
1037926126 8:22845427-22845449 CAGGAGGCTGAGGTTGAGCCTGG + Intronic
1038262393 8:26007675-26007697 CAAACCACAGAGCTGGAGCCAGG + Intronic
1038713138 8:29967189-29967211 CAGGAGGAAGAGCTGGGGCGTGG + Intergenic
1039176273 8:34810370-34810392 CAGCAGAAAGAGATGGAGGCTGG + Intergenic
1040877616 8:52169206-52169228 AAGAAGCCAGAGCTTGAGCCTGG + Intronic
1040886046 8:52265197-52265219 AAGGAGATAGAGCAGGAGCCTGG + Intronic
1041390958 8:57347227-57347249 CAGGAGAGACAGCTGGCGGCAGG - Intergenic
1041748771 8:61236821-61236843 CAGGTCACAGAGCTGGCGCAGGG + Intronic
1042661590 8:71160551-71160573 CAAGATAGAGAGCTGGAGCTGGG - Intergenic
1043825777 8:84926996-84927018 CAGGAGAGAGTGCTAGAGCAAGG + Intergenic
1043875794 8:85484603-85484625 CAGCAGACACAGATGGAGCCAGG - Intergenic
1044152548 8:88799783-88799805 CAGGAGAGAGAGCAAGAGCAGGG - Intergenic
1044900454 8:96938371-96938393 TAGGTGACAGAGCAGGACCCTGG + Intronic
1045548292 8:103147945-103147967 CATGAGACAGAGTGGGAGTCAGG - Intronic
1046475469 8:114736953-114736975 CAGGAGAAAGGGCGGGAGGCAGG - Intergenic
1046805280 8:118473245-118473267 CAGGGGACAGAGCAAGACCCAGG - Intronic
1047233219 8:123015470-123015492 CGGGAGACACAACTGGGGCCAGG - Exonic
1047249197 8:123168990-123169012 CAGGAGCAAGTGCTGGTGCCAGG - Intergenic
1048267516 8:133000500-133000522 CAGGAGGCAGAGCTGGCATCTGG + Intronic
1049022920 8:139970220-139970242 CAGGCGGCAGAGCTGGGACCTGG - Intronic
1049211067 8:141386652-141386674 CAAGAGGCAGAGCCGCAGCCGGG - Intergenic
1049236135 8:141513311-141513333 CAGCGGAGGGAGCTGGAGCCTGG + Intergenic
1049236243 8:141513824-141513846 CAGGGGCCTGAGCTGGGGCCTGG - Intergenic
1049255670 8:141612358-141612380 GAGGGGACAGAGCTGGTGCCTGG + Intergenic
1049344775 8:142132979-142133001 CAGATGACAGAGCTGAGGCCCGG - Intergenic
1049576872 8:143393640-143393662 CAGTGGACAGAGCTGAGGCCTGG - Intergenic
1049643742 8:143727032-143727054 CAGGAGGCGGAGCGGCAGCCGGG - Exonic
1049999223 9:1058473-1058495 CAAGAGGCTGAGGTGGAGCCTGG - Intergenic
1052382352 9:27785161-27785183 CTGGAAACAGAGCTGAAGCCAGG - Intergenic
1052798695 9:32947353-32947375 CAGGGAACAAAGCTGGGGCCTGG - Intergenic
1053459449 9:38257401-38257423 GAGGAGGAAGAGGTGGAGCCGGG - Intergenic
1054458722 9:65450458-65450480 CTGGAGCCAGGGCTGGAGCCAGG + Intergenic
1055583564 9:77732833-77732855 CAGGTGAGAGAGCTGGATCAGGG + Intronic
1055626225 9:78179635-78179657 CAGGGAACAAAGCTGGAGCCTGG - Intergenic
1056178921 9:84062644-84062666 AAGGAGACAGAACTGGGTCCTGG + Intergenic
1056261179 9:84850454-84850476 AAGGTGATAAAGCTGGAGCCAGG + Intronic
1056623536 9:88235279-88235301 CAGGACGCAGGGCAGGAGCCTGG + Intergenic
1056743393 9:89279692-89279714 CAGGAGACACGGCAGGAGCTAGG - Intergenic
1056788573 9:89610704-89610726 CAGGCCAGAGAGCTGGCGCCAGG - Intergenic
1057039980 9:91840847-91840869 AATGAAACAGAGCTGGAGCATGG - Intronic
1057064819 9:92038742-92038764 CAGCAGGCAGTGCTGGAGCTGGG - Intronic
1057076142 9:92139113-92139135 AAGGAGACAGAGAAGGAGCAGGG - Intergenic
1057619146 9:96619540-96619562 CAGGAGCCGGAGGAGGAGCCCGG + Exonic
1057822685 9:98344609-98344631 CAGGAGAGAGAGCTGTCCCCAGG - Intronic
1057859186 9:98625960-98625982 CAGGGGACAGAGCTTAAGACAGG + Intronic
1058872318 9:109213268-109213290 AAGGAGACAGGGCAGAAGCCAGG - Intronic
1059452821 9:114381372-114381394 CAGGAGACAGAGCTGCTGCCAGG + Exonic
1060104473 9:120865239-120865261 GCTGAGCCAGAGCTGGAGCCAGG - Intronic
1060183101 9:121547283-121547305 CAGGAGGCTGAGCTTGAGCCTGG - Intergenic
1060406727 9:123376502-123376524 CATGAGGCAGAGCAGGAGCAGGG - Intronic
1060469753 9:123938653-123938675 CAGGATTCAGAGCTGAAGGCTGG - Intergenic
1060550438 9:124482455-124482477 CAGGAGAGAGAGCTGGGAGCAGG + Exonic
1060766614 9:126298718-126298740 CAGTAGAAACAGCTGGAGCAAGG - Intergenic
1060967187 9:127717838-127717860 AAGGAGACAGAGCTGGGCCCAGG - Intronic
1061315885 9:129795569-129795591 TAGGAGAGAGAGCAGGTGCCTGG + Intergenic
1061426402 9:130501144-130501166 CAGGGAACAAAGCTGGGGCCTGG - Exonic
1061502894 9:131013859-131013881 CAGGAGACCCAGCTGGCTCCAGG - Intronic
1061969212 9:134034878-134034900 CAGGAGCCAGGGCTGCATCCAGG + Intronic
1062080838 9:134622587-134622609 AAGGAGACAGGGATGGAGGCAGG - Intergenic
1062080869 9:134622686-134622708 AAGGAGACAGGGATGGAGGCAGG - Intergenic
1062080900 9:134622787-134622809 AAGGAGACAGGGATGGAGGCAGG - Intergenic
1062092802 9:134687351-134687373 GAGGAGACAGGGCTGGAGCTTGG + Intronic
1062114054 9:134798084-134798106 CAGGTGACACAGCCGGTGCCAGG - Intronic
1062262697 9:135670830-135670852 CAGGCGAGAGGGCTGGAGGCGGG - Intergenic
1062286879 9:135777302-135777324 CTGGAGTCAGGGCTGGAGTCAGG - Intronic
1062294848 9:135818965-135818987 AAGCAGACTGAGCAGGAGCCTGG - Intronic
1062320150 9:135986747-135986769 CAGGGGTCAGAGATGCAGCCGGG - Intergenic
1062347588 9:136122522-136122544 CAGGGTACAGGGCAGGAGCCTGG + Intergenic
1185475089 X:410469-410491 TAGGAGACAGAGCTGATGCTTGG - Intergenic
1185820126 X:3194897-3194919 CAGGAGAGAGAGCAAGAGCAGGG - Intergenic
1185836158 X:3347021-3347043 CAGGAGAGAGAGAAGGAGCAGGG + Intergenic
1186280951 X:7992518-7992540 CAGAGGACAGAGCTGGAACCAGG - Intergenic
1187253739 X:17622718-17622740 CAGGGCACAGAGCAGGATCCTGG + Intronic
1188284797 X:28314491-28314513 CAGGAGGCAGAGCTAGACCAGGG - Intergenic
1188442370 X:30224904-30224926 CCTGAGCCAGAGCTGCAGCCAGG + Intergenic
1188444607 X:30243067-30243089 AAGAAGAGAGAGCTGGAGCCCGG + Exonic
1189130855 X:38496595-38496617 CTGTAGACAGAGCTGGGGCCAGG + Intronic
1189292273 X:39894837-39894859 GAGGGGACAGGGCTGGAGCCTGG + Intergenic
1190420687 X:50281472-50281494 CAGGCGACAGAGCCGGACGCTGG - Intronic
1192151992 X:68718306-68718328 CTGGAGCCTGAGCCGGAGCCAGG - Exonic
1192184921 X:68940453-68940475 GAGGAGCCAGAGCTGGAGGTTGG - Intergenic
1192239930 X:69320871-69320893 CAGGGGAAAGACCTGGAGGCTGG - Intergenic
1193080830 X:77404487-77404509 CAAGAGCCAGAGCTTGAGCCAGG - Intergenic
1194038735 X:88914412-88914434 CAGGTGTCAGAGGTGGGGCCTGG - Intergenic
1194128616 X:90051175-90051197 CAGGAGATAGAGCTGGGCCAGGG - Intergenic
1196042256 X:111217548-111217570 CCAGAGACAGAGCTGCACCCAGG + Intronic
1196044285 X:111240549-111240571 AAGGAGACACAGCTCGTGCCAGG - Intergenic
1196385998 X:115151882-115151904 CAGGAGACAGAGCTGGAGCCAGG + Intronic
1196829278 X:119763543-119763565 CAGGAGGCAGGGCCGGATCCAGG + Intergenic
1199442193 X:147881013-147881035 CAGGAGGCAGAGCTGGGCCAGGG - Intergenic
1199815167 X:151391344-151391366 CAGGAGCTAGAGGTGCAGCCTGG + Intergenic
1200046735 X:153407168-153407190 CCGGAGGCTGAGCTGGAGCGTGG - Intergenic
1200184452 X:154173083-154173105 CAGGAGGCTGAGCGGGAGCGGGG - Intergenic
1200190104 X:154210221-154210243 CAGGAGGCTGAGCGGGAGCGGGG - Intergenic
1200195857 X:154248023-154248045 CAGGAGGCTGAGCGGGAGCGGGG - Intergenic
1200201511 X:154285141-154285163 CAGGAGGCTGAGCGGGAGCGGGG - Intronic
1201668400 Y:16487033-16487055 CAGGAGACTCAGTTTGAGCCAGG - Intergenic