ID: 1196388133

View in Genome Browser
Species Human (GRCh38)
Location X:115181179-115181201
Sequence CAGTGTAACTAGAGGGAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 177}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196388127_1196388133 7 Left 1196388127 X:115181149-115181171 CCTGACAGGTACAAAGAACAGCA 0: 1
1: 0
2: 1
3: 29
4: 209
Right 1196388133 X:115181179-115181201 CAGTGTAACTAGAGGGAAATGGG 0: 1
1: 0
2: 1
3: 16
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196388133 Original CRISPR CAGTGTAACTAGAGGGAAAT GGG Intronic
901905639 1:12407162-12407184 CATTGTCCCAAGAGGGAAATAGG + Intronic
902099364 1:13973278-13973300 CAGTGGATCTAGAGGGGAAAGGG - Intergenic
905514956 1:38555839-38555861 CAGGGTTACTGGAGGGAAAGGGG + Intergenic
905603136 1:39271087-39271109 CAGTGAAACTACTGGGATATGGG + Intronic
907861413 1:58357243-58357265 CAGTGAGAACAGAGGGAAATGGG + Intronic
909039458 1:70631487-70631509 GAGAGAAACTAGACGGAAATGGG - Intergenic
909421800 1:75475587-75475609 CAGTTAAAATAGTGGGAAATGGG - Intronic
909537017 1:76748348-76748370 CAGTGTAACCATATAGAAATGGG + Intergenic
911650045 1:100377365-100377387 TAGAGTAACTAGAGGGCATTAGG + Intronic
913594959 1:120366455-120366477 CAGTGTGACTACAGGGACAGAGG - Intergenic
914092309 1:144512531-144512553 CAGTGTGACTACAGGGACAGAGG + Intergenic
914306222 1:146421339-146421361 CAGTGTGACTACAGGGACAGAGG - Intergenic
914595828 1:149151469-149151491 CAGTGTGACTACAGGGACAGAGG + Intergenic
916446870 1:164880741-164880763 TAGTGTGTCTAGAGGGAAGTAGG + Intronic
916946028 1:169728280-169728302 CAGTGGAACTAGAGAGTACTTGG + Intronic
917787269 1:178472203-178472225 CAGTCTAACTAAAGGAAAGTAGG - Intronic
919092286 1:192990506-192990528 CAGTGTAAGTATATGAAAATAGG - Intergenic
919962945 1:202490639-202490661 CAGCGTTGCCAGAGGGAAATGGG - Intronic
920991324 1:210942669-210942691 CTGTGTAACTTCAGGAAAATGGG + Intronic
922684570 1:227629232-227629254 CAGTTTAACTTGAAGGGAATGGG + Intronic
1063594925 10:7425804-7425826 CATTGTAAGTAGAGAGAAACAGG + Intergenic
1064619062 10:17195869-17195891 AAGAGTAACTAGAAGGAAAGAGG + Intronic
1065797961 10:29324300-29324322 CAGTGTAACAAGAAGGGAACTGG + Intergenic
1066440872 10:35437216-35437238 CAGTGTCACTTGACGGAACTGGG + Intronic
1067574311 10:47398775-47398797 GAGTGTAAAGAGAAGGAAATTGG + Intergenic
1067978937 10:51060065-51060087 CAGTGTTACTAGAGTTAAAAAGG - Intronic
1069031782 10:63603808-63603830 CAGTATAACTTGAGGCAAATAGG - Intronic
1069130568 10:64696820-64696842 CAGTGTAAATTGGGGAAAATGGG + Intergenic
1070394395 10:75999550-75999572 CAGAGGAACTAGAGGCACATTGG - Intronic
1071917058 10:90305248-90305270 TAGTGAAACAGGAGGGAAATTGG - Intergenic
1072837395 10:98730556-98730578 CAGTCTAACTAAAGGTATATCGG - Intronic
1073519570 10:104114609-104114631 CAGTTTAAATTGAGGAAAATTGG - Intergenic
1074221602 10:111443662-111443684 AAGTATAACTTGAAGGAAATAGG + Intergenic
1077485538 11:2836844-2836866 CAGGGGCCCTAGAGGGAAATGGG + Intronic
1078252262 11:9625947-9625969 CACTGTAACAAGAGGGAAGAAGG - Intergenic
1078474159 11:11616681-11616703 CAGTGGTACTAGAGACAAATAGG - Intronic
1079005072 11:16785793-16785815 CAGTCTGACTAGGGGAAAATGGG - Intronic
1079794625 11:24785066-24785088 TAGTGTAACTACAGGGAAGAAGG - Intronic
1079869258 11:25776032-25776054 TATTGCAACTAGAGGGAAAATGG + Intergenic
1080813764 11:35733563-35733585 CACTCCAACTAGAGGGAAGTAGG - Intronic
1081394507 11:42569703-42569725 CAGAGTAAATGAAGGGAAATTGG - Intergenic
1081806342 11:45892869-45892891 TAGAGGAACCAGAGGGAAATGGG + Intronic
1083894083 11:65611533-65611555 CAGGGGAACTAGAGGGGAGTAGG + Intronic
1084281534 11:68098487-68098509 AAGGGTAACTAGGTGGAAATGGG + Intronic
1085550690 11:77368141-77368163 CAGTATAAATAGATGTAAATAGG + Intronic
1086443860 11:86853862-86853884 TGGTGAAACTAGAGGGAAGTAGG - Intronic
1087234643 11:95704544-95704566 AAGTGCAATTAGAGGGAAAGGGG + Intergenic
1090488663 11:127138208-127138230 TAGAGCAATTAGAGGGAAATTGG - Intergenic
1092023909 12:5224908-5224930 CAGGGTAGCTAGGGGTAAATGGG - Intergenic
1094270360 12:28607955-28607977 CAGTCTAACAAGATGGAAAAAGG - Intergenic
1095607148 12:44082419-44082441 CAGTGTATCTATAGGGATATAGG + Intronic
1095752321 12:45727284-45727306 AATTGTAACTAGAGGGAGAACGG - Intergenic
1096315779 12:50564029-50564051 CAGTTTAACTATGGGGAAATAGG - Intronic
1096377906 12:51129588-51129610 TAGAGTAACTAAAGGGAAAGAGG + Intronic
1097926951 12:65139324-65139346 CAGTGTGGCTAGAGAGAAATGGG - Intergenic
1098508086 12:71278364-71278386 CAGTGTGTTTAGGGGGAAATGGG - Intronic
1099269812 12:80493817-80493839 AAGTGTCACTAAAGGTAAATAGG + Intronic
1100169818 12:91961382-91961404 CAATGCAACTAGGAGGAAATGGG + Intergenic
1103517074 12:121514872-121514894 GAGTGTAATTAGAGGGGGATAGG - Intronic
1103517094 12:121514940-121514962 GAGTGTAATTAGAGGGGGATAGG - Intronic
1103949082 12:124541725-124541747 GAGTGGAACTGGAGGGAGATGGG + Intronic
1104652578 12:130546884-130546906 AAGTGAAACTACAGGGAAATAGG - Intronic
1105556984 13:21456653-21456675 CATTTTAACTAGAGAGAATTTGG - Intronic
1106208174 13:27618946-27618968 CAGGGTAACTAGTGGGATAAAGG + Intronic
1107247627 13:38316210-38316232 CAGTGAAACTATAAGGATATAGG - Intergenic
1107320876 13:39186679-39186701 CAGTGGAATTACTGGGAAATTGG + Intergenic
1108677674 13:52751282-52751304 CAGTGTAACTAGAGGCTGATGGG + Intergenic
1108764362 13:53608584-53608606 CAGGGTTCCTAAAGGGAAATGGG - Intergenic
1109477915 13:62908730-62908752 CAGTGTAAATAGAAAGAACTAGG - Intergenic
1109839770 13:67906374-67906396 TGGTGAAACTAGAGGGAAGTAGG + Intergenic
1111141892 13:84129611-84129633 GAGAGTAAGTAGAGGGAAGTAGG + Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112381306 13:98893174-98893196 CAGTGTAACCAGAGCGAAATCGG + Intronic
1114334110 14:21670177-21670199 CAGTGTAACTACAGTGAGATGGG + Intergenic
1114691118 14:24582537-24582559 CAGAGTAGTTAGAGGGAAACAGG + Intergenic
1117188388 14:53266226-53266248 CACTGTAATTAGAATGAAATAGG - Intergenic
1118246617 14:64116811-64116833 AGGGGTAACAAGAGGGAAATTGG + Intronic
1119437155 14:74605075-74605097 CACTGGAACTAGAGGGTAAGAGG + Intronic
1121049023 14:90807991-90808013 CAGTGAAACTAGTTGGAAGTGGG + Intronic
1126115466 15:45203583-45203605 CAGTGTACCTAGAGATAAGTAGG - Intergenic
1127817420 15:62623740-62623762 CAGTAAAACCAAAGGGAAATAGG - Intronic
1128664914 15:69531020-69531042 CAGGGTAAACTGAGGGAAATGGG - Intergenic
1130789760 15:87141463-87141485 TAGTGTAACCTGAGAGAAATAGG + Intergenic
1132471787 16:108323-108345 CAGTATAACAAGTGGGGAATGGG - Intronic
1133593843 16:7271965-7271987 CCGAGTAACAAGAGGGGAATAGG - Intronic
1134084554 16:11347363-11347385 GAGTCTAACTAGAGGCAGATAGG + Intronic
1135458692 16:22622134-22622156 CAGAGGAACTCGGGGGAAATAGG - Intergenic
1135747530 16:25029889-25029911 CCCTGTAACTTGAGGGAATTTGG - Intergenic
1138230667 16:55333290-55333312 CAGTGTCACTAGATGGACACTGG + Intergenic
1139307744 16:66001923-66001945 TAGTCTAGCTAGAGAGAAATTGG + Intergenic
1140792944 16:78409843-78409865 GATTGTGGCTAGAGGGAAATGGG - Intronic
1146828736 17:36047837-36047859 CAGTGTAGGAAGAGGGAGATGGG - Intergenic
1146953699 17:36923566-36923588 CAGTGTAGCTAAAGGGAGAGAGG + Intergenic
1147110106 17:38256227-38256249 CACTGTCACTTGAGGGAAAGGGG + Intergenic
1148419407 17:47532194-47532216 CACTGTCACTTGAGGGAAAGGGG - Intronic
1148541401 17:48483516-48483538 CAGTGGAACAGGAGGGGAATTGG - Intergenic
1149301015 17:55304692-55304714 GGCTGTAGCTAGAGGGAAATGGG + Intronic
1154987872 18:21570647-21570669 CATTTTAACTATAGGGAGATGGG + Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155991848 18:32286394-32286416 CAGTGTAACTTCAGGGATATAGG + Intronic
1159399157 18:67907615-67907637 CACTGTAAATATGGGGAAATTGG + Intergenic
1165460855 19:35943603-35943625 TAGGGGAACCAGAGGGAAATTGG + Intronic
925057723 2:868218-868240 CAGTGTATTTACATGGAAATTGG - Intergenic
926027934 2:9560889-9560911 CTGTGGAACTGGAGGGTAATTGG - Intergenic
927486548 2:23492040-23492062 CAGAGGAACTGGAGGGAAAAAGG - Intronic
929241665 2:39659779-39659801 CAGTGGAAACAGAGAGAAATGGG - Intergenic
932348257 2:71010210-71010232 TGGTGAAACTAGAGGGAAGTAGG + Intergenic
932351134 2:71033090-71033112 TGGTGAAACTAGAGGGAAGTAGG + Intergenic
932663360 2:73676554-73676576 CAGTGTAAATGGAGGTAAACGGG + Intergenic
934713780 2:96531657-96531679 CAGGGCAACTAAAGGGAAAAGGG + Intergenic
935065188 2:99641206-99641228 CAGTGTCACTGGAGGGACACAGG - Intronic
937548441 2:123055004-123055026 CACTGTTACAAGAGAGAAATAGG - Intergenic
938906619 2:135842787-135842809 CAGTGTCACTGGGGTGAAATGGG + Intronic
939319142 2:140593350-140593372 CAGGGTAACTGCAGGGAGATAGG + Intronic
939568043 2:143807965-143807987 CAGTGTCATTTGAGGGGAATAGG + Intergenic
940870677 2:158857732-158857754 TGGTGAAACTAGAGGGAAGTAGG + Intronic
942293052 2:174490678-174490700 CAGCGGGACTTGAGGGAAATCGG - Intergenic
942548927 2:177094114-177094136 CATAGTAACTAAAGGCAAATTGG - Intergenic
946391543 2:219419408-219419430 CAGTGTAGCCAGAGGGAGAAGGG + Intronic
947989985 2:234479197-234479219 CAATGTAACTAGAGGGGAAAAGG - Intergenic
1169434379 20:5572656-5572678 AAGTGAAACTAGGGGGAAAATGG - Intronic
1170196532 20:13694643-13694665 CAGTGTGACTAGAGGGACTTGGG - Intergenic
1172066555 20:32224791-32224813 CTGTCTAGCAAGAGGGAAATAGG + Intronic
1176995261 21:15548135-15548157 CAAGGTGACTACAGGGAAATAGG + Intergenic
1178173926 21:30075616-30075638 CACTGTAAATGGGGGGAAATTGG - Intergenic
1179224656 21:39443038-39443060 CAGTGTTTGTAGAGTGAAATGGG + Intronic
1184575354 22:45359950-45359972 CTGTGTAATTACAGGGAAGTGGG - Exonic
949880049 3:8654495-8654517 CAGTGTAACTGCAGGGAAGTAGG - Intronic
949885736 3:8692312-8692334 TGGTGAAACTAGAGGGAAGTAGG + Intronic
950168748 3:10821467-10821489 AAGTGTAACCAGAGGAAAATGGG + Intronic
950738314 3:15029295-15029317 CAGGGTAACTAGAGTGATAGTGG + Intronic
952168354 3:30776722-30776744 CAGTCTAACTAGAAGGAAGAGGG - Intronic
957043250 3:75353338-75353360 TGGTGAAACTAGAGGGAAGTAGG - Intergenic
959581669 3:107988959-107988981 AAGTGTAACTAAGGGGGAATGGG - Intergenic
961273397 3:125707512-125707534 TGGTGAAACTAGAGGGAAGTAGG + Intergenic
963877644 3:150494464-150494486 CATTGTAACTAGAAAGTAATGGG - Intergenic
964671726 3:159233430-159233452 CTGGGTAACTAATGGGAAATGGG + Intronic
966903535 3:184505369-184505391 CAAGGTAACTAAAGGTAAATAGG + Intronic
967819179 3:193825611-193825633 CGGTGTGACTCGAGGGAACTCGG - Intergenic
969026793 4:4179635-4179657 TGGTGAAACTAGAGGGAAGTAGG - Intergenic
970500574 4:16672750-16672772 CAGTGTTACTGCAGGGAAAGAGG - Intronic
977247596 4:94651609-94651631 CAGTCTAACCAGAGGCAAGTGGG - Intronic
977711558 4:100132537-100132559 CAGTGAAACTGAAAGGAAATAGG - Intergenic
979518928 4:121643648-121643670 CAGTGTAAATAAAGGGAAGAGGG - Intergenic
988196565 5:28012806-28012828 CAGTGCAAAAAGAGGGGAATTGG - Intergenic
988399742 5:30747516-30747538 CTGTGGCAATAGAGGGAAATAGG - Intergenic
988681207 5:33485834-33485856 GAGTTTTACTAGAAGGAAATCGG - Intergenic
991748379 5:69770679-69770701 AAATGTACATAGAGGGAAATGGG + Intergenic
991799959 5:70350524-70350546 AAATGTACATAGAGGGAAATGGG + Intergenic
991828641 5:70659515-70659537 AAATGTACATAGAGGGAAATGGG - Intergenic
991892314 5:71349955-71349977 AAATGTACATAGAGGGAAATGGG + Intergenic
993882760 5:93381970-93381992 CAGGGAAACTAGAGAGAAACAGG + Intergenic
996479186 5:123954274-123954296 CATGGCAAATAGAGGGAAATTGG - Intergenic
1004979964 6:21012396-21012418 CAGGGTAACTAGATGGGACTGGG - Intronic
1006609570 6:35286098-35286120 GAGTGGAAATAGAGAGAAATGGG - Intronic
1007269855 6:40628235-40628257 CAGAGTCACAAGAGGGAAACCGG + Intergenic
1007497392 6:42269405-42269427 CCGTGTATCTTGAGGGAAGTGGG + Exonic
1007597871 6:43062736-43062758 CAGTGGAGGTAGTGGGAAATTGG + Intronic
1007867518 6:44989188-44989210 CAGTGTAACCAAAGGGTGATGGG - Intronic
1011477699 6:87764024-87764046 CATGGAAACCAGAGGGAAATGGG + Intergenic
1013296033 6:108759224-108759246 CAGTGTAACAAGGGGGACCTTGG - Intergenic
1013615868 6:111842516-111842538 CAGTGTGAATAGGGGGACATTGG - Intronic
1014273727 6:119363621-119363643 CAATGAAACTAGAGGGAGAAAGG + Intergenic
1015485628 6:133766797-133766819 GAGTGTAAGAAGAGGGAAAAAGG + Intergenic
1016074272 6:139777562-139777584 CAGTATCACCAGAGGGAATTGGG + Intergenic
1016154188 6:140783278-140783300 GAGTGTAACAAGAGGGAAGGAGG + Intergenic
1016446078 6:144133247-144133269 CAGTGTGAATGGAGGGAAAGTGG - Intergenic
1017984329 6:159429901-159429923 GAGTGTGACCAGAGGGAAGTTGG - Intergenic
1025966943 7:66282247-66282269 CACAGTGATTAGAGGGAAATGGG - Intronic
1029361314 7:100090384-100090406 CTGTTTAACTAGAGGGGAAGGGG - Exonic
1030478523 7:110071296-110071318 CAGTGTCACTGGAGGGAATTTGG - Intergenic
1031687130 7:124744764-124744786 CTGAGTAACTAAAGGTAAATAGG - Intergenic
1031982560 7:128137025-128137047 CAGTGTAACTGGGGAGAAAGGGG - Intergenic
1032958859 7:137006357-137006379 CAGTGTCATAAGGGGGAAATGGG - Intronic
1036902516 8:12681228-12681250 TGGTGAGACTAGAGGGAAATAGG - Intergenic
1037055693 8:14438570-14438592 AAGTGTTCCTAGAGGGAATTAGG + Intronic
1041131073 8:54701001-54701023 CTGGGGAACTAGAGGGAGATGGG + Intergenic
1043437915 8:80252414-80252436 CAGTGGAACTTCAGGGGAATGGG - Intergenic
1044572522 8:93735265-93735287 CAGGGTCACTAGAGAGAGATAGG - Exonic
1044823774 8:96177521-96177543 CTGTGTCACTAGAGAGAAAAAGG - Intergenic
1046008502 8:108515922-108515944 CAGTGGAACTAGAAGAAAAGGGG - Intergenic
1046520920 8:115324593-115324615 CAGTGTCACTAAAGGCAAATTGG + Intergenic
1048375122 8:133816565-133816587 CAGTGGAACCAGAGGGAATTTGG + Intergenic
1048393585 8:133990961-133990983 CAGGGCAACTGGAGGAAAATGGG + Intergenic
1054977069 9:71160077-71160099 CAGTATAACTAGAGCTGAATAGG - Intronic
1055188379 9:73485965-73485987 CAATGTAAATATAAGGAAATTGG + Intergenic
1056863739 9:90211397-90211419 TGGTGAAACTAGAGGGAAGTAGG + Intergenic
1056916169 9:90748047-90748069 TGGTGAAACTAGAGGGAAGTAGG - Intergenic
1057964117 9:99486947-99486969 CACTGAACCTAGAGGGTAATAGG + Intergenic
1059099621 9:111457488-111457510 CATTGTAACAGGAGGGAAACAGG + Intronic
1189654396 X:43226842-43226864 GGGTGTAAGTAGAGGGAAATTGG + Intergenic
1195431938 X:104798715-104798737 CAGTGAAAGAAGATGGAAATGGG - Intronic
1196388133 X:115181179-115181201 CAGTGTAACTAGAGGGAAATGGG + Intronic
1198024789 X:132694461-132694483 CAGTGTGATTAGAGAAAAATGGG + Intronic
1198194172 X:134343364-134343386 CAGGGTAAATAAAGGTAAATTGG - Intergenic