ID: 1196388965

View in Genome Browser
Species Human (GRCh38)
Location X:115189940-115189962
Sequence ACGCTGTGAGCCAGGCTCGA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1165
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 1136}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196388965_1196388976 25 Left 1196388965 X:115189940-115189962 CCGTCGAGCCTGGCTCACAGCGT 0: 1
1: 0
2: 1
3: 27
4: 1136
Right 1196388976 X:115189988-115190010 CCGACTGTGTCGGGGCAAGATGG 0: 1
1: 0
2: 0
3: 2
4: 44
1196388965_1196388974 17 Left 1196388965 X:115189940-115189962 CCGTCGAGCCTGGCTCACAGCGT 0: 1
1: 0
2: 1
3: 27
4: 1136
Right 1196388974 X:115189980-115190002 GGAAGGCACCGACTGTGTCGGGG 0: 1
1: 0
2: 0
3: 6
4: 48
1196388965_1196388969 -5 Left 1196388965 X:115189940-115189962 CCGTCGAGCCTGGCTCACAGCGT 0: 1
1: 0
2: 1
3: 27
4: 1136
Right 1196388969 X:115189958-115189980 AGCGTTGGCTGTGGAATGCGCGG 0: 1
1: 0
2: 1
3: 7
4: 86
1196388965_1196388970 -4 Left 1196388965 X:115189940-115189962 CCGTCGAGCCTGGCTCACAGCGT 0: 1
1: 0
2: 1
3: 27
4: 1136
Right 1196388970 X:115189959-115189981 GCGTTGGCTGTGGAATGCGCGGG 0: 1
1: 0
2: 0
3: 3
4: 59
1196388965_1196388973 16 Left 1196388965 X:115189940-115189962 CCGTCGAGCCTGGCTCACAGCGT 0: 1
1: 0
2: 1
3: 27
4: 1136
Right 1196388973 X:115189979-115190001 GGGAAGGCACCGACTGTGTCGGG 0: 1
1: 0
2: 0
3: 5
4: 128
1196388965_1196388971 0 Left 1196388965 X:115189940-115189962 CCGTCGAGCCTGGCTCACAGCGT 0: 1
1: 0
2: 1
3: 27
4: 1136
Right 1196388971 X:115189963-115189985 TGGCTGTGGAATGCGCGGGAAGG 0: 1
1: 0
2: 1
3: 6
4: 135
1196388965_1196388972 15 Left 1196388965 X:115189940-115189962 CCGTCGAGCCTGGCTCACAGCGT 0: 1
1: 0
2: 1
3: 27
4: 1136
Right 1196388972 X:115189978-115190000 CGGGAAGGCACCGACTGTGTCGG 0: 1
1: 0
2: 0
3: 1
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196388965 Original CRISPR ACGCTGTGAGCCAGGCTCGA CGG (reversed) Exonic
900665966 1:3815720-3815742 ACTCTGTCACCCAGGCTGGAGGG + Intronic
900770555 1:4539891-4539913 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
900976847 1:6022914-6022936 TCGCTGTCACCCAGGCTGGAGGG + Intronic
901117608 1:6860876-6860898 ACTCTGTCACCCAGGCTGGAGGG - Intronic
901344080 1:8523159-8523181 ACGCTGTCACCCAGGCTGGATGG - Intronic
901479639 1:9516065-9516087 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
901564011 1:10097003-10097025 ACTCTGTCACCCAGGCTGGAGGG - Intronic
901567366 1:10129678-10129700 ACTCTGTCACCCAGGCTGGATGG + Intronic
901809676 1:11760545-11760567 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
901884325 1:12212148-12212170 ACTCTGTGACCCAGGCTGGAGGG + Intergenic
901891745 1:12272149-12272171 ACTCTGTCACCCAGGCTAGAGGG - Intronic
902234722 1:15049983-15050005 ACTCTGTCATCCAGGCTGGAGGG - Intronic
902416106 1:16240459-16240481 ACTCTGTCACCCAGGCTAGAGGG + Intergenic
902499395 1:16899059-16899081 ACTCTGTCACCCAGGCTGGAGGG - Intronic
902523716 1:17039583-17039605 ACTCTGTCATCCAGGCTGGAAGG - Intronic
902608554 1:17583169-17583191 ACTCTGTCACCCAGGCTGGAGGG - Intronic
902966835 1:20011209-20011231 TCACTGTGGGCCAGGCACGATGG + Intergenic
903053634 1:20619880-20619902 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
903225605 1:21892827-21892849 ACTCTGTCACCCAGGCTGGAAGG - Intronic
903254357 1:22083569-22083591 ACTCTGTCAGCCAGGCTGGAGGG - Intronic
903430726 1:23297483-23297505 ACTCTGTCATCCAGGCTGGAGGG + Intergenic
903494739 1:23758005-23758027 ACTCTGTCATCCAGGCTGGAGGG - Intronic
903629860 1:24759925-24759947 ACTCTGTGGCCCAGGCTGGAGGG - Intronic
903769015 1:25752452-25752474 ATGCTGTGGGCCAGGCACGGTGG - Intronic
903801001 1:25968130-25968152 ACTCTGTCACCCAGGCTGGAAGG - Intronic
903902974 1:26661940-26661962 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
903985406 1:27223881-27223903 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
904085098 1:27900696-27900718 ACTCTGTTACCCAGGCTGGAGGG + Intronic
904133615 1:28293824-28293846 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
904394488 1:30209622-30209644 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
904544998 1:31262485-31262507 ACTCTGTCACCCAGGCTAGAGGG - Intronic
904645439 1:31962332-31962354 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
904723726 1:32530960-32530982 ACTCTGTCACCCAGGCTAGAAGG + Intronic
904753092 1:32753449-32753471 TCGCTGTCACCCAGGCTGGAGGG - Intronic
904760430 1:32800012-32800034 ACTCTGTCACCCAGGCTGGAGGG + Intronic
904836677 1:33342189-33342211 ACGCTGAGGGCAAGGCTGGAGGG - Intronic
904850669 1:33456915-33456937 ACTCTGTCATCCAGGCTGGAGGG + Intergenic
905186601 1:36201622-36201644 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
905190868 1:36233478-36233500 ACTCTGTCACCCAGGCTGGAAGG - Intronic
905555856 1:38883684-38883706 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
905784996 1:40748163-40748185 ACTCTGTCACCCAGGCTGGAGGG + Intronic
906426879 1:45722218-45722240 ACTCTGTCACCCAGGCTAGAGGG - Intronic
906687426 1:47771684-47771706 CCGCTGAGAGCCAGGCTTGGGGG - Intronic
907084158 1:51653966-51653988 ACTCTGTCACCCAGGCTGGAAGG - Intronic
907409922 1:54276573-54276595 ACTCTGTCACCCAGGCTGGAGGG - Intronic
908029156 1:59981653-59981675 ACGCTGTGGGCCAGGTTCTGTGG - Intergenic
908518397 1:64916805-64916827 ACTCTGTCACCCAGGCTGGATGG - Intronic
908525866 1:64986836-64986858 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
908530470 1:65029128-65029150 ACTCTGTCACCCAGGCTAGAGGG + Intergenic
908596677 1:65695955-65695977 ACGCTGTCGCCCAGGCTGGAGGG + Intergenic
909053399 1:70794897-70794919 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
909079553 1:71092999-71093021 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
909183863 1:72460268-72460290 ACTCTGTCACCCAGGCTAGAGGG - Intergenic
909773144 1:79451251-79451273 ACTCTGTCACCCAGGCTGGACGG - Intergenic
910017513 1:82545748-82545770 ACTCTGTCATCCAGGCTGGAGGG + Intergenic
910403977 1:86866161-86866183 ACTCTGTCACCCAGGCTGGAAGG - Intronic
911203681 1:95071507-95071529 ACGCTGTTGCCCAGGCTGGAGGG - Intronic
911604626 1:99889544-99889566 ACTCTGTCACCCAGGCTGGAGGG - Intronic
911730995 1:101292366-101292388 ACTCTGTCACCCAGGCTGGATGG + Intergenic
911847068 1:102767349-102767371 ACTCTGTCACCCAGGCTGGAAGG + Intergenic
912375174 1:109203844-109203866 ACTCTGTCACCCAGGCTGGATGG - Intronic
913136959 1:115900193-115900215 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
913525931 1:119692966-119692988 ACTCTGTCACCCAGGCTGGATGG + Intronic
913995236 1:143646429-143646451 ACTCTGTGGCCCAGGCTGGAGGG - Intergenic
914049344 1:144118778-144118800 ACTCTGTGGCCCAGGCTGGAGGG - Intergenic
914129840 1:144846666-144846688 ACTCTGTGGCCCAGGCTGGAGGG + Intergenic
914301376 1:146380263-146380285 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
914753742 1:150551855-150551877 ACTCTGTCATCCAGGCTGGAGGG - Intronic
914836528 1:151211449-151211471 ACTCTGTCACCCAGGCTGGAGGG - Intronic
915069795 1:153257328-153257350 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
915119554 1:153620425-153620447 ACTCTGTCACCCAGGCTGGAGGG - Intronic
915537729 1:156547518-156547540 ACTCTGTCACCCAGGCTAGAGGG - Intronic
915538070 1:156549602-156549624 ACTCTGTCACCCAGGCTAGAGGG - Intronic
915745990 1:158158291-158158313 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
916099383 1:161381073-161381095 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
916415810 1:164590876-164590898 ACTCTGTCACCCAGGCTGGAGGG + Intronic
916776228 1:167967754-167967776 ACTCTGTCACCCAGGCTGGAAGG + Intronic
917845073 1:179013983-179014005 ACCCTGTCACCCAGGCTGGAAGG - Intergenic
917849190 1:179045858-179045880 ACTCTGTCACCCAGGCTGGAGGG - Intronic
918190140 1:182165770-182165792 ACCCTGTCACCCAGGCTGGAGGG - Intergenic
918802023 1:188984853-188984875 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
920023654 1:202975798-202975820 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
920082664 1:203386485-203386507 ACTCTGTCACCCAGGCTAGAGGG - Intergenic
920093944 1:203473677-203473699 GCTCTGTGACCCAGGCTGGAGGG + Intergenic
920355487 1:205369016-205369038 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
920493335 1:206436382-206436404 ACTCTGTCACCCAGGCTGGAGGG + Intronic
921042169 1:211443364-211443386 ACTCTGTGTCCCAGGCTGGATGG - Intergenic
921202230 1:212818527-212818549 ACGCTGTCACCCAGGCTGGAGGG + Intergenic
921338145 1:214108434-214108456 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
922155017 1:223034318-223034340 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
922511351 1:226170811-226170833 ACTCTGTCACCCAGGCTGGAGGG + Intronic
922525820 1:226302511-226302533 ACTCTGTCACCCAGGCTGGATGG - Intronic
923156098 1:231280686-231280708 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
923492049 1:234492741-234492763 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
923508409 1:234626925-234626947 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
923694191 1:236230576-236230598 ACTCTGTCACCCAGGCTGGAGGG - Intronic
923748967 1:236728858-236728880 ACCCTGTGGCCCAGGCTGGAGGG - Intronic
924104655 1:240638177-240638199 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
924114493 1:240731647-240731669 ACTCTGTTACCCAGGCTGGAGGG - Intergenic
924191442 1:241556853-241556875 GCTCTGTCAGCCAGGCTGGAGGG - Intronic
924203446 1:241685042-241685064 ATGCTGTGGGCCAGGCACGGTGG - Intronic
924291163 1:242537836-242537858 ACTCTGTCATCCAGGCTGGAGGG + Intergenic
924304526 1:242673394-242673416 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
924750228 1:246880532-246880554 ACTCTGTCTGCCAGGCTGGATGG - Intronic
924936257 1:248773984-248774006 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1062876266 10:945348-945370 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1063411989 10:5843208-5843230 CCTCTGTGACCCAGGCTAGAGGG - Intergenic
1063459415 10:6205829-6205851 ACACTGTCACCCAGGCTGGAGGG + Intronic
1063516219 10:6698373-6698395 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1063649170 10:7915942-7915964 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1063674029 10:8123897-8123919 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1064087000 10:12352573-12352595 ACTCTGTGGCCCAGGCTGGAGGG - Intronic
1064183133 10:13136472-13136494 TCGCTGTCACCCAGGCTGGAGGG - Intronic
1064265022 10:13819092-13819114 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1064406235 10:15066205-15066227 ACTCTGTTGGCCAGGCTGGAGGG - Intronic
1064614030 10:17134214-17134236 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1064732224 10:18344401-18344423 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1064853907 10:19742826-19742848 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1064922518 10:20533833-20533855 ACCCTGTCACCCAGGCTGGATGG + Intergenic
1065032161 10:21598594-21598616 AAACTGTGGGCCAGGCGCGATGG + Intronic
1065046238 10:21749509-21749531 ACTCTGTCACCCAGGCTAGATGG + Intergenic
1065356112 10:24843295-24843317 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1065503782 10:26409010-26409032 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1065702672 10:28440859-28440881 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1066116873 10:32248451-32248473 ACTCTGTCACCCAGGCTGGATGG + Intergenic
1066233473 10:33461517-33461539 ACTCTGTCAGCCAGGCTGGAAGG - Intergenic
1066359290 10:34714806-34714828 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1068747139 10:60546067-60546089 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1068831379 10:61499044-61499066 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1068848138 10:61704188-61704210 ACTCTGTCACCCAGGCTGGAAGG - Intronic
1069327570 10:67250247-67250269 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1069404542 10:68084952-68084974 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1069433235 10:68356214-68356236 ATACTGTGAGCCAGGCGCGGTGG + Intronic
1070072273 10:73101351-73101373 ACTCTGTTATCCAGGCTGGAGGG - Intergenic
1070128260 10:73639154-73639176 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1070486183 10:76934004-76934026 ACTCTGTTACCCAGGCTGGAGGG + Intronic
1070804284 10:79261616-79261638 ACTCTGTGAAGCAGGCTCCAAGG + Intronic
1071531323 10:86392120-86392142 CAGCTGTGAGACAGGCTCCACGG + Intergenic
1071556223 10:86603986-86604008 ACACTGTCACCCAGGCTGGAGGG - Intergenic
1072110410 10:92314176-92314198 ACTCTGTCACCCAGGCTAGAGGG - Intronic
1072120699 10:92403305-92403327 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1072356509 10:94616983-94617005 ACGCTGTCACCCAGGCTGGAGGG - Intergenic
1072385850 10:94927598-94927620 ACTCTGTCACCCAGGCTAGAGGG + Intergenic
1072577781 10:96716246-96716268 ACTCTGTCATCCAGGCTGGAGGG - Intronic
1072801893 10:98397914-98397936 GCTCTGTGACCCAGGCTGGAGGG + Intronic
1073092534 10:100954222-100954244 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1073459940 10:103660614-103660636 ACGTTCTGAGCCAGGGTCCAGGG - Intronic
1073705497 10:105979415-105979437 ACCCTGTCACCCAGGCTGGAGGG + Intergenic
1073754129 10:106562819-106562841 ACTCTGTCATCCAGGCTGGAGGG + Intergenic
1073828832 10:107358678-107358700 ACTCTGTCACCCAGGCTGGATGG + Intergenic
1074414821 10:113258743-113258765 ACTCTGTCACCCAGGCTGGATGG + Intergenic
1075702994 10:124481408-124481430 ACTGTGTGACCCAGGCTGGAGGG + Intronic
1075771763 10:124944517-124944539 ACTCTGTCACCCAGGCTAGAGGG + Intronic
1075962810 10:126584084-126584106 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1076245815 10:128946497-128946519 ACTCTGTCAGCCAGGCTGGATGG - Intergenic
1076583017 10:131526539-131526561 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1076740773 10:132483127-132483149 ACTCTGTCACCCAGGCTAGAGGG - Intergenic
1077403066 11:2368518-2368540 ACTCTGTGGGCCTGGCTTGAGGG - Intergenic
1077616472 11:3678102-3678124 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1078371214 11:10747102-10747124 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1078442041 11:11376346-11376368 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1079203344 11:18393832-18393854 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1079210230 11:18454835-18454857 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1080071623 11:28095720-28095742 ACTCTGTGGGCCAGGCTCGGTGG + Intronic
1080666738 11:34343001-34343023 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1081051257 11:38343950-38343972 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1081097934 11:38963712-38963734 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1081527923 11:43939641-43939663 ACTCTGTCACCCAGGCTGGAAGG + Intronic
1081787760 11:45759324-45759346 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1081907604 11:46679522-46679544 ACGCTCTGATGCAGGCTAGAGGG + Intronic
1083023364 11:59529775-59529797 ACTCTGTCGCCCAGGCTCGAGGG + Intergenic
1083028888 11:59573986-59574008 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1083080482 11:60087160-60087182 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1083108766 11:60384452-60384474 ATGTTGTGTGCCAGGCACGAGGG - Intronic
1083244822 11:61418750-61418772 ACTCTGTCACCCAGGCTGGAAGG + Intronic
1083275299 11:61593709-61593731 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1083320691 11:61844513-61844535 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1083548368 11:63565638-63565660 ACTCTGTAACCCAGGCTGGAGGG - Intergenic
1083925980 11:65806854-65806876 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1084121929 11:67074428-67074450 ACTCTGTCATCCAGGCTGGAGGG - Intergenic
1084219204 11:67667267-67667289 ACCCTGTGATGCAGGCTCCATGG - Intronic
1084266369 11:68007426-68007448 GCCCTGTGAGCCAGGCTCAGGGG + Intergenic
1084299225 11:68235449-68235471 CCGCTGTGGGCCAGGCACGGTGG + Intergenic
1084330833 11:68429217-68429239 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1084391285 11:68878822-68878844 GCTCTGTGGGCCAGGCTGGAGGG - Intergenic
1084439009 11:69160218-69160240 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1084843227 11:71875989-71876011 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1084864361 11:72043394-72043416 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1084927104 11:72522617-72522639 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1084997804 11:72999351-72999373 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1084999207 11:73014163-73014185 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1085626439 11:78077256-78077278 ACTCTGTCACCCAGGCTAGAGGG - Intronic
1086962853 11:92997659-92997681 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1088006384 11:104945878-104945900 ACTCTGTCATCCAGGCTAGAGGG + Intronic
1088264408 11:107975719-107975741 ACTCTGTCATCCAGGCTGGAGGG - Intergenic
1088272810 11:108052346-108052368 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1088682472 11:112255627-112255649 TCCCTCTGAGCCAAGCTCGAGGG + Intronic
1088883430 11:113989327-113989349 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1089427419 11:118390847-118390869 ACGTTGTCAGCCAGGCATGATGG + Intronic
1089439270 11:118501433-118501455 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1089607140 11:119648028-119648050 ACTCTGTCACCCAGGCTAGAAGG - Intronic
1090123428 11:124057625-124057647 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1090309853 11:125726218-125726240 AATCTTTGAGCCAGGCGCGATGG + Intergenic
1090368204 11:126225945-126225967 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1090544868 11:127753946-127753968 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1091716170 12:2777704-2777726 ACTCTGTCTGCCAGGCTGGAGGG - Intergenic
1091868034 12:3859526-3859548 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1091872494 12:3906213-3906235 ACTCTGTCACCCAGGCTTGAGGG + Intergenic
1092240400 12:6832633-6832655 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1092738389 12:11605812-11605834 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1092781141 12:11988461-11988483 ACTCTGTGACCCAGGCTGGATGG + Intergenic
1092841882 12:12550237-12550259 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1093229710 12:16528834-16528856 ATGCAGTGAGCCTGGCTAGAAGG + Intronic
1093733855 12:22595965-22595987 ACTCTGTCACCCAGGCTAGAGGG - Intergenic
1093890628 12:24516074-24516096 ACTCTGTCAGCCAGGTTGGAGGG + Intergenic
1093940617 12:25050091-25050113 ACTCTGTCACCCAGGCTGGATGG - Intronic
1094168520 12:27466674-27466696 AGGCTGAGAGACAGGCTAGAAGG + Intergenic
1094671255 12:32571419-32571441 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1094749361 12:33387781-33387803 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1095731958 12:45515884-45515906 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1095892277 12:47246102-47246124 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1096140774 12:49240933-49240955 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1096279723 12:50242387-50242409 ACTCTGTCACCCAGGCTGGAAGG + Intronic
1096420153 12:51449993-51450015 ACTCTGTCACCCAGGCTAGAGGG - Intronic
1096502921 12:52076122-52076144 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1096654811 12:53082384-53082406 ACCCTGTCACCCAGGCTAGAGGG + Intergenic
1096679158 12:53243261-53243283 TAGCTGAGAGCCAGGCTCGGTGG + Intergenic
1096884193 12:54700096-54700118 ACTCTCTGTGCCAGGCTCCATGG + Intergenic
1097289425 12:57901446-57901468 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1097766168 12:63529762-63529784 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1097825706 12:64172784-64172806 ACTCTATGAGCCATGCTGGAAGG - Intergenic
1097875715 12:64641360-64641382 ACTCTGTCACCCAGGCTGGAAGG - Intronic
1097891116 12:64778809-64778831 TCTCTGTGAGCCGGGCGCGATGG - Intergenic
1097935109 12:65239512-65239534 ACTCTGTCATCCAGGCTGGAGGG - Intronic
1098135134 12:67394064-67394086 ACTCTGTCACCCAGGCTAGAGGG - Intergenic
1098681342 12:73358594-73358616 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1098990147 12:77057084-77057106 ACTCTGTAACCCAGGCTGGAGGG + Intronic
1099064480 12:77956773-77956795 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1099168687 12:79338308-79338330 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1099385770 12:82011173-82011195 ACGCTATGAGCCAGGCGCGGTGG - Intergenic
1099747779 12:86728655-86728677 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1099957698 12:89367394-89367416 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1100317391 12:93457358-93457380 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1100464084 12:94829961-94829983 AAGCTATAAGCCAGGCACGATGG + Intergenic
1100625121 12:96323425-96323447 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1100820532 12:98425532-98425554 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1100848097 12:98680582-98680604 GCTCTGTGACCCAGGCTGGAGGG + Intronic
1101152232 12:101893962-101893984 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1101682345 12:106981548-106981570 ACTCTGTCACCCAGGCTGGACGG + Intronic
1101864552 12:108510806-108510828 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1102088149 12:110161172-110161194 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1102376462 12:112425760-112425782 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1102709692 12:114915215-114915237 AATCTGGGAGCCAGGCTCGGTGG - Intergenic
1102994316 12:117336828-117336850 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1103105343 12:118219631-118219653 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1103215402 12:119197977-119197999 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1103434368 12:120913577-120913599 ACCCTGTCACCCAGGCTGGAGGG + Intergenic
1103573529 12:121860122-121860144 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1103638064 12:122325513-122325535 ACTCTGTGGCCCAGGCTGGAGGG + Intronic
1103679912 12:122685341-122685363 ACTCTGTCACCCAGGCTAGAAGG + Intergenic
1103707005 12:122880828-122880850 CCTCTGTGTGCCAGGCTCGGGGG + Intronic
1104126765 12:125854741-125854763 ACTCTGTCACCCAGGCTGGATGG + Intergenic
1105269419 13:18857321-18857343 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1106051713 13:26196597-26196619 ACTCTGTCACCCAGGCTAGAGGG - Intronic
1106497857 13:30297107-30297129 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1107013024 13:35686359-35686381 ACTCTGTCAGCCAGGCTGGAGGG + Intergenic
1107378176 13:39827384-39827406 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1107574595 13:41704495-41704517 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1107870489 13:44742040-44742062 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1107877575 13:44804224-44804246 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1107904468 13:45049433-45049455 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1108290549 13:48955892-48955914 ACTCTGTCACCCAGGCTGGATGG + Intergenic
1109065808 13:57688277-57688299 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1109071534 13:57775272-57775294 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1109087707 13:57997444-57997466 ATTCTGTCACCCAGGCTCGAGGG + Intergenic
1109711631 13:66168254-66168276 ACTCTGTCACCCAGGCTGGAAGG + Intergenic
1110222186 13:73085187-73085209 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1110376278 13:74797322-74797344 ACGCTGTTGCCCAGGCTGGAGGG - Intergenic
1111474530 13:88726998-88727020 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1111477873 13:88776755-88776777 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1111623948 13:90759431-90759453 ACTCTGTCATCCAGGCTGGAGGG + Intergenic
1112006324 13:95256722-95256744 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1112011731 13:95299223-95299245 AAGCTGTGACCCAGGCTGGAGGG - Intronic
1113855725 13:113444437-113444459 ACGGTGTGTGCCAGGCGAGAAGG + Exonic
1114157391 14:20119802-20119824 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1114277570 14:21161308-21161330 ACTCTGTCAGCCAGGCTGGAGGG + Intergenic
1114511909 14:23269267-23269289 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1115036352 14:28861379-28861401 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1115605271 14:34994811-34994833 ACTCTGTCACCCAGGCTGGATGG + Intronic
1115831112 14:37342325-37342347 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1116449694 14:45050646-45050668 ACTCTGTCACCCAGGCTAGAGGG + Intronic
1116846806 14:49872298-49872320 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1117359212 14:54956606-54956628 ACTCTGTCACCCAGGCTGGATGG - Intronic
1117858510 14:60062657-60062679 AGGCTTTGAGCTAGGCTCTAGGG - Intronic
1118401805 14:65386468-65386490 ACTCTGTGGCCCAGGCTGGAGGG - Intergenic
1118403590 14:65401861-65401883 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1119035877 14:71230465-71230487 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1119044139 14:71302673-71302695 ACTCTGTCACCCAGGCTCGAGGG + Intergenic
1119527147 14:75331874-75331896 ACTCTGTCACCCAGGCTTGAGGG + Intergenic
1119839878 14:77784112-77784134 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1120087718 14:80293928-80293950 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1120320770 14:82957552-82957574 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1120779503 14:88474221-88474243 ACTCTGTCACCCAGGCTGGATGG + Intronic
1120916772 14:89717320-89717342 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1122174062 14:99903815-99903837 ACTCTGTCACCCAGGCTAGAGGG + Intronic
1122360393 14:101157082-101157104 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1122571319 14:102704463-102704485 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1122687371 14:103515915-103515937 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1122872684 14:104647915-104647937 ACCCTGTCACCCAGGCTGGATGG + Intergenic
1122967064 14:105136195-105136217 ACTCTGTCACCCAGGCTTGAGGG - Intergenic
1202829907 14_GL000009v2_random:16688-16710 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1123419281 15:20118349-20118371 ACTCTGTGGCCCAGGCTGGAGGG - Intergenic
1123446585 15:20335150-20335172 ACTCTGTGGCCCAGGCTGGAGGG + Intergenic
1123469922 15:20542214-20542236 AAGCTTTGAGCCAGGCGTGATGG + Intergenic
1123528503 15:21124892-21124914 ACTCTGTGGCCCAGGCTGGAGGG - Intergenic
1123648133 15:22458467-22458489 AAGCTTTGAGCCAGGCGTGATGG - Intergenic
1123730216 15:23137236-23137258 AAGCTTTGAGCCAGGCGTGATGG + Intergenic
1123748354 15:23334646-23334668 AAGCTTTGAGCCAGGCGTGATGG + Intergenic
1124027219 15:25977714-25977736 ACCCTGTCACCCAGGCTGGATGG + Intergenic
1124280732 15:28358533-28358555 AAGCTTTGAGCCAGGCATGATGG + Intergenic
1124301972 15:28553096-28553118 AAGCTTTGAGCCAGGCATGATGG - Intergenic
1125197130 15:37059962-37059984 ACGCTGTCACGCAGGCTGGAGGG + Intronic
1125551192 15:40546223-40546245 ACCCTGTCACCCAGGCTGGAGGG + Intronic
1125632499 15:41158706-41158728 ACCCTGTCACCCAGGCTGGAGGG - Intergenic
1125643834 15:41253816-41253838 ACTCTGTCACCCAGGCTCGAGGG + Intronic
1125693516 15:41616142-41616164 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1125822584 15:42645484-42645506 ACGCTGTCATCCAGGCTTTATGG + Intronic
1125853350 15:42925393-42925415 ACCCTGTCACCCAGGCTGGAGGG + Intergenic
1126052742 15:44701663-44701685 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1126107003 15:45153185-45153207 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1126794351 15:52247873-52247895 ACAGTGTGAGCCAGGCACGGAGG - Intronic
1127158820 15:56158529-56158551 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1127203520 15:56686170-56686192 ACTCTGTTACCCAGGCTGGAGGG + Intronic
1127511211 15:59643629-59643651 ACTCTGTGGCCCAGGCTGGAGGG + Intronic
1128069311 15:64784319-64784341 ACTCTGTTACCCAGGCTGGAGGG - Intergenic
1128410872 15:67395753-67395775 ACTCTGTCATCCAGGCTGGAGGG + Intronic
1128790148 15:70427229-70427251 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1128990978 15:72260279-72260301 ACTCTGTCATCCAGGCTGGAGGG - Intronic
1129021289 15:72521575-72521597 CCTCTGTCAGCCAGGCTGGAGGG + Intronic
1129095322 15:73200706-73200728 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1129106542 15:73312642-73312664 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1129173209 15:73820647-73820669 ACTCTGTCACCCAGGCTGGATGG - Intergenic
1129184699 15:73898828-73898850 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1129601166 15:76999310-76999332 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1129825495 15:78632339-78632361 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1129879005 15:78994959-78994981 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1131042189 15:89280053-89280075 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1131072558 15:89475267-89475289 ACTCTGTCATCCAGGCTGGAGGG + Intronic
1131462949 15:92632481-92632503 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1131491099 15:92863613-92863635 ACTCTGTCACCCAGGCTAGATGG - Intergenic
1132060980 15:98692302-98692324 ACACTGTCACCCAGGCTAGAGGG - Intronic
1132115349 15:99131713-99131735 AGGATGTGAGCCAGGCTGCAAGG + Exonic
1132385771 15:101398934-101398956 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1202982508 15_KI270727v1_random:377280-377302 ACTCTGTGTCCCAGGCTCCAGGG + Intergenic
1132493132 16:245309-245331 ACTCTGTGGCCCAGGCTGGAGGG - Intronic
1132812890 16:1810126-1810148 TCGCTGTCACCCAGGCTGGAGGG - Intronic
1132922531 16:2405718-2405740 ACTCTGTCAGCCAGGCTGGAGGG - Intergenic
1133293128 16:4735668-4735690 AAACTGTCAGCCAGGCGCGATGG + Intronic
1133599296 16:7323388-7323410 ACTCTGTCACCCAGGCTGGAAGG - Intronic
1133636234 16:7668420-7668442 ATGCTGTGAGCCAGACACGAAGG + Intronic
1134749590 16:16615382-16615404 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1134857950 16:17536361-17536383 ACTCTGTCACCCAGGCTGGAAGG - Intergenic
1134889335 16:17825015-17825037 ACTCTGTCACCCAGGCTGGAAGG - Intergenic
1134995879 16:18738242-18738264 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1135116002 16:19723924-19723946 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1135127369 16:19822350-19822372 ACTCTGTCACCCAGGCTGGAAGG - Intronic
1135593022 16:23718426-23718448 ACTCTGTCACCCAGGCTGGAAGG - Intergenic
1135642445 16:24132812-24132834 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1135922975 16:26667809-26667831 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1136619952 16:31421962-31421984 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1136846448 16:33580232-33580254 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1136853025 16:33628758-33628780 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1137388442 16:48061169-48061191 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1137485871 16:48890705-48890727 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1137594658 16:49715709-49715731 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1137639390 16:50014720-50014742 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1137702142 16:50504903-50504925 CAGCTCTGAGCCAGGCTGGAAGG - Intergenic
1138147403 16:54624926-54624948 GCTCTGTCAGCCAGGCTGGAAGG + Intergenic
1138268687 16:55679259-55679281 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1138367284 16:56490793-56490815 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1138478561 16:57286367-57286389 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1138559193 16:57790111-57790133 ACTCTGTGGCCCAGGCTGGAGGG + Intronic
1138965681 16:62081252-62081274 ACCCTGTTACCCAGGCTGGAGGG - Intergenic
1139412425 16:66774714-66774736 ACTCTATGACCCAGGCTGGAGGG + Intronic
1139726058 16:68899631-68899653 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1140392249 16:74597395-74597417 ACTCTGTCATCCAGGCTGGAGGG - Intronic
1140523726 16:75604397-75604419 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1140745153 16:77974594-77974616 ACTCTGTCACCCAGGCTTGAGGG + Intronic
1141182764 16:81765595-81765617 ACTCTGTCATCCAGGCTGGAGGG - Intronic
1141529386 16:84635652-84635674 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1141637401 16:85321757-85321779 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1142244280 16:88962374-88962396 ACGCCATGAACCAGCCTCGAAGG + Intronic
1142399284 16:89850867-89850889 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1203108156 16_KI270728v1_random:1428887-1428909 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1203114621 16_KI270728v1_random:1477182-1477204 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1203137811 16_KI270728v1_random:1740376-1740398 ACTCTGTGGCCCAGGCTGGAGGG + Intergenic
1142514966 17:421682-421704 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1142568064 17:853412-853434 ACTCTGTCAGCCAGGTTAGAAGG - Intronic
1143168345 17:4910567-4910589 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1143607527 17:7997891-7997913 ACTCTGTCACCCAGGCTGGAAGG - Intergenic
1143816792 17:9523023-9523045 ACACTGTAAGCCAGGCTCGGTGG + Intronic
1143922678 17:10343229-10343251 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1143976100 17:10831099-10831121 AGGCTGTGAGCCAGGTGCCATGG - Intronic
1144900327 17:18581820-18581842 ACACTGTTACCCAGGCTGGAGGG + Intergenic
1145227765 17:21144782-21144804 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1145882122 17:28359999-28360021 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1145893991 17:28441169-28441191 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1146010695 17:29192104-29192126 ACTCTGTGGCCCAGGCTGGAGGG - Intergenic
1146071431 17:29685753-29685775 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1146199303 17:30842233-30842255 ACTCTGTTACCCAGGCTGGAAGG - Intronic
1146353381 17:32114462-32114484 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1147021041 17:37533365-37533387 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1147060300 17:37870638-37870660 AAACTGTGGGCCAGGCGCGATGG - Intergenic
1147272107 17:39280531-39280553 ACTCTGTCACCCAGGCTCAAGGG - Intronic
1147734782 17:42629042-42629064 ACTCTGTCATCCAGGCTGGAAGG + Intergenic
1147843772 17:43390806-43390828 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1147883207 17:43667160-43667182 ACCCTGTGAGGCAGGCTGGCAGG - Intergenic
1148015399 17:44518397-44518419 ACTCTGTTACCCAGGCTGGAGGG - Intergenic
1148230925 17:45934303-45934325 GCTCTGTCAGCCAGGCTAGAGGG - Intronic
1148257416 17:46147540-46147562 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1148409578 17:47453127-47453149 AAACTGTGGGCCAGGCACGATGG - Intergenic
1148612421 17:48973156-48973178 ACTCTGTCATCCAGGCTGGAGGG - Intergenic
1148646345 17:49221747-49221769 ACTCTGTCATCCAGGCTGGATGG + Intronic
1148903547 17:50896781-50896803 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1149212212 17:54316722-54316744 TAGCTGTGAGCAAGGCTCCATGG - Intergenic
1149246700 17:54717190-54717212 ACTCTGTCACCCAGGCTAGAGGG + Intergenic
1149369834 17:55982307-55982329 ACCCTGTCACCCAGGCTGGAGGG - Intergenic
1149760401 17:59223986-59224008 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1149898799 17:60453904-60453926 ACTCTGTCACCCAGGCTAGAGGG + Intronic
1149926942 17:60710834-60710856 ACTTTGTCACCCAGGCTCGAGGG + Intronic
1150050353 17:61956566-61956588 ACTCTGTCACCCAGGCTGGATGG + Intronic
1150070171 17:62143632-62143654 GCTCTGTGACCCAGGCTGGAGGG + Intergenic
1150073023 17:62168688-62168710 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1150110581 17:62495690-62495712 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1150363529 17:64560183-64560205 ACTCTGTCACCCAGGCTCCATGG - Intronic
1150676444 17:67248302-67248324 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1150724988 17:67644466-67644488 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1150765403 17:67997964-67997986 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1151229363 17:72672413-72672435 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1151273196 17:73012830-73012852 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1151368646 17:73633249-73633271 TCTCTGTCAGCCAGGCTGGAGGG - Intronic
1151794904 17:76337629-76337651 ACTCTGTCACCCAGGCTGGAAGG + Intronic
1151970540 17:77455338-77455360 GTGCTGCCAGCCAGGCTCGACGG - Intronic
1152056382 17:78031065-78031087 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1152231098 17:79114557-79114579 ACGCTGGGAGCCAGGCTGGACGG + Intronic
1152390013 17:79998359-79998381 ACTCTGTGACCCAGGTTGGAGGG + Intronic
1152482949 17:80567756-80567778 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1152868452 17:82737770-82737792 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1153108568 18:1557820-1557842 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1153738727 18:8100170-8100192 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1154211504 18:12382847-12382869 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1154215422 18:12412219-12412241 ACTCTGTTACCCAGGCTGGAGGG + Intronic
1154418620 18:14202670-14202692 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1154951332 18:21213173-21213195 ACTCTGTCACCCAGGCTGGATGG + Intergenic
1155075227 18:22348664-22348686 ACGCGCCGAGCCAGGCTCGCGGG + Intergenic
1155238137 18:23841886-23841908 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1155281745 18:24247497-24247519 ACTCTGTCACCCAGGCTAGAAGG + Intronic
1155788656 18:29935176-29935198 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1155960912 18:31993976-31993998 ACTCTGTCATCCAGGCTGGAGGG - Intergenic
1156029093 18:32691502-32691524 ACTCTGTTATCCAGGCTGGAAGG - Intronic
1156669299 18:39448214-39448236 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1156738975 18:40300832-40300854 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1157244044 18:46038092-46038114 ACTCTGTCACCCAGGCTAGAGGG + Intronic
1157246502 18:46059281-46059303 ACTCTGTCACCCAGGCTGGATGG + Intronic
1157262699 18:46189828-46189850 ACTCTGTCACCCAGGCTAGAGGG - Intronic
1157696798 18:49729555-49729577 ACTCTGTCATCCAGGCTGGAGGG - Intergenic
1157742765 18:50107936-50107958 ACCCTGTTACCCAGGCTGGATGG + Intronic
1158203156 18:54961943-54961965 ACTCTGTTACCCAGGCTGGAGGG - Intergenic
1159346520 18:67213687-67213709 GCTCTGTGAGCCAGGCAGGATGG - Intergenic
1160513393 18:79465390-79465412 ACCCCGTGAGGCAGGCTGGATGG - Intronic
1160513438 18:79465525-79465547 ACCCTGTGGGACAGGCTGGATGG - Intronic
1160580337 18:79880281-79880303 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1160975692 19:1791242-1791264 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1160983756 19:1828156-1828178 AGGCTGTGAGCCAGCCCCGGCGG - Exonic
1161144962 19:2672015-2672037 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1161333949 19:3701125-3701147 ACTCTGTGGCCCAGGCTGGAGGG - Intergenic
1161355694 19:3818430-3818452 ACTCTGTTACCCAGGCTGGAGGG - Intronic
1161403737 19:4080760-4080782 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1161855934 19:6765458-6765480 ACGCTGGGGGCCAGGCGCGGTGG + Intronic
1161950576 19:7465440-7465462 ACTCTGTCACCCAGGCTTGAGGG + Intronic
1162200422 19:9015902-9015924 ACTCTGTCACCCAGGCTGGATGG - Intergenic
1162205049 19:9049536-9049558 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1162205861 19:9055452-9055474 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1162223740 19:9202087-9202109 AATCTTTGGGCCAGGCTCGATGG - Intergenic
1162406471 19:10477390-10477412 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1162442292 19:10700477-10700499 AGGTTGTGAGCCAGGCACGGTGG - Intergenic
1162538524 19:11278680-11278702 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1162880944 19:13658794-13658816 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1163005098 19:14392332-14392354 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1163015650 19:14452358-14452380 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1163035793 19:14568076-14568098 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1163040208 19:14596598-14596620 ACTCTGTCATCCAGGCTGGAGGG - Intronic
1163050037 19:14676065-14676087 ACTCTGTCACCCAGGCTGGAAGG - Intronic
1163246592 19:16099111-16099133 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1163340947 19:16706694-16706716 ACTCTGTTACCCAGGCTGGATGG - Intergenic
1163619386 19:18349213-18349235 ACTCTGTCATCCAGGCTGGAGGG + Intronic
1163690977 19:18738281-18738303 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1163750554 19:19074626-19074648 AAGCTATGAGACAGGCTCAAGGG + Intronic
1163800817 19:19364086-19364108 ACTCTGTGGTCCAGGCTGGAGGG - Intergenic
1163839394 19:19596875-19596897 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1163958223 19:20663744-20663766 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1163975932 19:20852411-20852433 AAGCAGTGAGCAAGGCTCCATGG - Intronic
1164246000 19:23429382-23429404 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1164549727 19:29199462-29199484 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1164970651 19:32529485-32529507 ACTCTGTGGCCCAGGCTGGAGGG - Intergenic
1164980341 19:32608925-32608947 TTGCAGTGAGCCAGGCTGGATGG - Intronic
1165069141 19:33245580-33245602 ACTCTGTCACCCAGGCTAGAGGG + Intergenic
1165092847 19:33395803-33395825 TGGGTGTGAGCCAGGCTCTAGGG + Intronic
1165207785 19:34205646-34205668 ACTCTGTCACCCAGGCTAGAAGG - Intronic
1165368019 19:35381600-35381622 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1166318316 19:42001260-42001282 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1166541483 19:43608595-43608617 ACTCTGTCACCCAGGCTGGAAGG - Intronic
1166549142 19:43653623-43653645 GCTCTGTCAGCCAGGCTGGAGGG - Intronic
1166591617 19:44004099-44004121 ACGTTGAGAGCAAGGCTCGTGGG + Intronic
1166809237 19:45506055-45506077 TCGCTGTCACCCAGGCTGGAGGG - Intergenic
1166963268 19:46512806-46512828 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1167145320 19:47678147-47678169 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1167242422 19:48352211-48352233 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1167342414 19:48923519-48923541 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1167522254 19:49962077-49962099 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1167558380 19:50210137-50210159 AGGCTGTGAACCAGGCTCAGAGG - Intronic
1167783214 19:51614176-51614198 ACTCTGTCATCCAGGCTGGAGGG + Intronic
1167884493 19:52489063-52489085 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1168095397 19:54111644-54111666 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1168097799 19:54125460-54125482 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1168159055 19:54496515-54496537 ACTCTGTCACCCAGGCTAGAGGG - Intergenic
1168484891 19:56752701-56752723 ACTCTGTTACCCAGGCTGGAGGG - Intergenic
1168648292 19:58075882-58075904 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1202642779 1_KI270706v1_random:111097-111119 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1202688792 1_KI270712v1_random:71673-71695 ACTCTGTGGCCCAGGCTGGAGGG - Intergenic
926330632 2:11822414-11822436 ACTCTGTCACCCAGGCTGGAGGG - Intronic
926750165 2:16192481-16192503 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
926779704 2:16458735-16458757 ACTCTGTCATCCAGGCTGGAGGG + Intergenic
927302459 2:21531264-21531286 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
927367416 2:22315898-22315920 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
927861083 2:26560612-26560634 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
928000812 2:27521750-27521772 ACGCTGTTACCCAGGCTGGAGGG + Intronic
928004018 2:27547205-27547227 ACTCTGTCACCCAGGCTAGAGGG + Intronic
929035370 2:37686020-37686042 ACTCTGTCACCCAGGCTAGAGGG - Intronic
929136141 2:38625488-38625510 ACTCTGTCACCCAGGCTAGAGGG + Intergenic
929512046 2:42572243-42572265 ACTCTGTCACCCAGGCTGGAGGG - Intronic
929521994 2:42661471-42661493 ACTCTGTTACCCAGGCTAGAGGG - Intronic
929582552 2:43091935-43091957 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
929902606 2:46018434-46018456 ACTCTGTGGCCCAGGCTGGAGGG - Intronic
930352727 2:50278100-50278122 ACTCTGTTACCCAGGCTGGAGGG + Intronic
930654534 2:53994483-53994505 ACTCTGTCACCCAGGCTGGAGGG - Intronic
930659450 2:54039324-54039346 ACTCTGTGGCCCAGGCTGGAGGG + Intronic
930675458 2:54196228-54196250 ACTCTGTCAGCCAGGCTCAAGGG + Intronic
931204061 2:60129953-60129975 ACTCTGTCACCCAGGCTAGAGGG - Intergenic
931310427 2:61074440-61074462 ACGCTGTCACCCAAGCTGGAGGG + Intronic
931362388 2:61588979-61589001 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
931408816 2:62008139-62008161 ACTCTGTCACCCAGGCTGGAGGG - Intronic
931491115 2:62748624-62748646 ACTCTGTCACCCAGGCTGGAGGG - Intronic
931541948 2:63339205-63339227 ACTCTGTCACCCAGGCTAGAGGG + Intronic
931659008 2:64539674-64539696 CTGCTGTGAGCCAGGCTCTGAGG + Intronic
932628571 2:73318872-73318894 ACTCTGTTACCCAGGCTGGAGGG + Intergenic
932637897 2:73408904-73408926 ACTCTGTCACCCAGGCTGGAGGG + Intronic
932724086 2:74162446-74162468 ACTCTGTCACCCAGGCTGGAGGG - Intronic
933607694 2:84401077-84401099 ACTCTGTCACCCAGGCTGGATGG - Intergenic
933683611 2:85125035-85125057 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
933817434 2:86079594-86079616 ACTCTGTTACCCAGGCTGGAGGG + Intronic
933957644 2:87384426-87384448 ACTCTGTGGTCCAGGCTGGAGGG + Intergenic
934127698 2:88914418-88914440 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
934241764 2:90276321-90276343 ACTCTGTGGTCCAGGCTGGAGGG + Intergenic
934271408 2:91540364-91540386 ACTCTGTGGTCCAGGCTGGAGGG - Intergenic
934572028 2:95378715-95378737 ACTCTGTCACCCAGGCTGGATGG - Intronic
935263323 2:101373898-101373920 ACTCTGTCACCCAGGCTGGAGGG + Intronic
935299188 2:101678938-101678960 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
936623894 2:114127678-114127700 ACTCTGTGGCCCAGGCTGGAGGG + Intergenic
936828101 2:116605948-116605970 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
937137940 2:119571486-119571508 ACTCTGTCACCCAGGCTAGAGGG + Intronic
937400393 2:121577964-121577986 ACTCTGTCACCCAGGCTAGAGGG + Intronic
937958363 2:127436644-127436666 ACTCTGTCACCCAGGCTGGACGG + Intronic
938416805 2:131110079-131110101 ACTCTGTCACCCAGGCTGGAGGG - Intronic
938616174 2:133001248-133001270 ACTCTGTCACCCAGGCTGGAAGG + Intronic
938773315 2:134519676-134519698 ACTCTGTCACCCAGGCTGGAGGG - Intronic
938889124 2:135684794-135684816 ACTCTGTTACCCAGGCTGGAGGG + Intronic
939122847 2:138138838-138138860 ACTGTGTCAGCCAGGCTGGATGG - Intergenic
939182281 2:138817486-138817508 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
940823382 2:158382885-158382907 ACTCTGTCACCCAGGCTGGAGGG - Intronic
941311248 2:163934812-163934834 ACTGTGTGACCCAGGCTGGAGGG - Intergenic
941439948 2:165522264-165522286 ACTCTGTCACCCAGGCTGGAGGG - Intronic
941723267 2:168835106-168835128 ACTCTGTGGCCCAGGCTGGAGGG + Intronic
941732810 2:168936920-168936942 ACTCTGTCACCCAGGCTGGAGGG + Intronic
941744123 2:169068359-169068381 ACGCTGTTACCCAGGCTGGAGGG + Intronic
942079449 2:172386219-172386241 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
942117408 2:172741703-172741725 ACTCTGTCACCCAGGCTGGAAGG + Intronic
943329114 2:186537600-186537622 ACTCTGTCACCCAGGCTGGAAGG + Intergenic
943759595 2:191593452-191593474 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
944406858 2:199394503-199394525 AGGCTGTGGGCCAGGCTCTGTGG + Intronic
944781300 2:203020635-203020657 ACTCTGTCACCCAGGCTGGAAGG - Intronic
944843875 2:203649599-203649621 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
944888898 2:204096629-204096651 ACTCTGTCATCCAGGCTGGAGGG - Intergenic
944936005 2:204568919-204568941 ACTCTGTCACCCAGGCTGGAGGG - Intronic
945315768 2:208369398-208369420 ACTCTGTTACCCAGGCTGGAGGG + Intronic
945899600 2:215523107-215523129 ACCCTGTCACCCAGGCTGGAGGG - Intergenic
945925381 2:215797583-215797605 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
946006764 2:216531783-216531805 ACTCTGTTACCCAGGCTGGAGGG - Intronic
946049133 2:216847129-216847151 ACTCTGTCATCCAGGCTGGAGGG + Intergenic
946272158 2:218603360-218603382 ACTCTGTCACCCAGGCTTGAGGG + Intergenic
946544980 2:220730037-220730059 ACTCTGTGGCCCAGGCTGGAGGG - Intergenic
946717703 2:222570555-222570577 ACTCTGTCACCCAGGCTGGAGGG + Exonic
946732752 2:222724881-222724903 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
947431286 2:230030515-230030537 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
947478010 2:230468782-230468804 ACTCTGTCAGCCAAGCTGGAGGG - Intronic
947480216 2:230492340-230492362 ACTCTGTCACCCAGGCTAGAGGG + Intronic
947504728 2:230699125-230699147 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
947799767 2:232921483-232921505 ACTCTGTTACCCAGGCTGGAGGG + Intronic
948239820 2:236420774-236420796 ACTCTGTCACCCAGGCTGGAGGG - Intronic
949036529 2:241818109-241818131 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1169035952 20:2452205-2452227 AGGCTGTGAGCCAGGCCCTAGGG + Intergenic
1169079480 20:2787467-2787489 ACTCTGTCACCCAGGCTGGATGG + Intergenic
1169372769 20:5041310-5041332 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1169904311 20:10585614-10585636 ACTCTGTCACCCAGGCTGGATGG + Intronic
1170466842 20:16629957-16629979 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1170774592 20:19364487-19364509 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1171030553 20:21672648-21672670 ACTCTGTCAGCCAGGCTGGAGGG + Intergenic
1171219771 20:23384586-23384608 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1171723335 20:28589146-28589168 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1171787932 20:29488603-29488625 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1172115839 20:32573066-32573088 TCGCTGTCACCCAGGCTGGATGG + Intronic
1172171031 20:32932341-32932363 ACGCTGTCGCCCAGGCTGGAGGG - Intronic
1172892505 20:38276952-38276974 ACTCTGTGGCCCAGGCTGGAAGG - Intronic
1172973773 20:38891766-38891788 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1172985866 20:38988594-38988616 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1173805036 20:45919217-45919239 ACTCTGTTACCCAGGCTGGAAGG + Intergenic
1173901978 20:46597017-46597039 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1173935947 20:46864731-46864753 ACTCTGTCACCCAGGCTGGAAGG + Intergenic
1174245327 20:49175295-49175317 ACTCTGTGGCCCAGGCTGGAGGG - Intronic
1174304770 20:49607287-49607309 AGGCTGGGTGCCAGGCACGATGG - Intergenic
1174474632 20:50787697-50787719 ACTCTGTGGCCCAGGCTGGAGGG - Intergenic
1174551059 20:51362021-51362043 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1174553834 20:51380105-51380127 ACTCTGTCATCCAGGCTGGAGGG - Intergenic
1174615726 20:51834021-51834043 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1174627472 20:51927562-51927584 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1174951904 20:55051253-55051275 ACTCTGTCACCCAGGCTAGAGGG - Intergenic
1175492439 20:59388396-59388418 AAGCTGTGAGCCAGGCCCTTTGG + Intergenic
1175638927 20:60610495-60610517 ACTCTGTCACCCAGGCTGGATGG + Intergenic
1175733374 20:61369415-61369437 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1175885859 20:62290448-62290470 ACGCTGTTCCCCAGGCTGGAGGG + Intronic
1175975067 20:62706819-62706841 GCTCTGTCACCCAGGCTCGAGGG - Intergenic
1176158061 20:63632882-63632904 ACTCTGTCACCCAGGCTGGATGG - Intergenic
1176184936 20:63773260-63773282 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1176609095 21:8861528-8861550 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1176668504 21:9709929-9709951 ACTCTGTTGGCCAGGCTGGAGGG + Intergenic
1176722552 21:10404017-10404039 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1176854678 21:13956620-13956642 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1177543275 21:22522951-22522973 ACTCTGTCACCCAGGCTGGATGG - Intergenic
1177776694 21:25575741-25575763 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1177818992 21:26010785-26010807 ACTCTGTCACCCAGGCTGGAAGG - Intronic
1177837527 21:26201036-26201058 ACTCTGTCACCCAGGCTGGAAGG - Intergenic
1178067145 21:28917486-28917508 ACTCTGTCACCCAGGCTGGATGG + Intergenic
1178470805 21:32891026-32891048 ACTCTGTCACCCAGGCTGGATGG - Intergenic
1178995803 21:37398306-37398328 ACTCTGTCACCCAGGCTGGAAGG - Intronic
1179001613 21:37465801-37465823 GCGCTGTTACCCAGGCTGGAGGG - Intronic
1179202688 21:39240932-39240954 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1179530733 21:42017513-42017535 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1179637069 21:42719604-42719626 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1179655445 21:42841851-42841873 ACGCTGGGTGCCAGGCTGGCAGG - Intergenic
1179824021 21:43953962-43953984 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1179985698 21:44919343-44919365 ACGCTGGGTGCCAGGCTGGCAGG + Intronic
1180104688 21:45610357-45610379 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1180303734 22:11056767-11056789 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1180359188 22:11871359-11871381 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1180411719 22:12617761-12617783 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1180552631 22:16552928-16552950 ACTCTGTGGCCCAGGCTGGAGGG + Intergenic
1180603903 22:17041020-17041042 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1180679791 22:17617321-17617343 ACTCTGTCACCCAGGCTAGATGG + Intronic
1180944727 22:19685914-19685936 ACTCTGTCACCCAGGCTGGATGG + Intergenic
1181084083 22:20431340-20431362 CCGCTGTGAGCCCGGCTGGTGGG - Exonic
1181336298 22:22132729-22132751 ACTCTGTTATCCAGGCTGGATGG - Intergenic
1181342954 22:22197653-22197675 ACACTGTGGGCCAGGCGCGGTGG + Intergenic
1181351398 22:22261108-22261130 ACTCTGTGGCCCAGGCTGGAGGG - Intergenic
1181549565 22:23629647-23629669 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1181828292 22:25537730-25537752 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1181837507 22:25622973-25622995 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1182066804 22:27436833-27436855 CCTCTGTGAGTCAGGCTCTAGGG - Intergenic
1182112776 22:27735150-27735172 GCTCTGTCAGCCAGGCTGGAGGG + Intergenic
1182118374 22:27771260-27771282 ACTCTGTCATCCAGGCTGGAAGG + Intronic
1182351038 22:29699939-29699961 TCGCTGTTACCCAGGCTGGAGGG - Intergenic
1182405953 22:30130622-30130644 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1182641560 22:31772031-31772053 ACTCTGTCACCCAGGCTAGAAGG - Intronic
1182666799 22:31966047-31966069 ACTCTGTTATCCAGGCTGGAGGG + Intergenic
1182813598 22:33138475-33138497 ACTCTGTCATCCAGGCTGGAGGG + Intergenic
1182832814 22:33317178-33317200 ACTCTGTCACCCAGGCTGGAAGG - Intronic
1182910816 22:33982662-33982684 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1183257911 22:36774776-36774798 ACGCTGTTGCCCAGGCTGGAGGG - Intronic
1183570162 22:38647175-38647197 ATGCTGTGTGCCAGGCACGGTGG + Intronic
1183827366 22:40399015-40399037 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1183838493 22:40477314-40477336 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1183962004 22:41416888-41416910 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1184100004 22:42337030-42337052 GTGCTGTGTGCCAGGCCCGAGGG - Intronic
1184360127 22:44011589-44011611 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1184443533 22:44533867-44533889 ACTCTGTTACCCAGGCTGGAGGG - Intergenic
1184531322 22:45057548-45057570 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1184648609 22:45909341-45909363 CTGCTGTGTGCCAGGCTCCAGGG + Intergenic
1184722697 22:46324399-46324421 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1184972424 22:48035460-48035482 ACTCTGTCACCCAGGCTAGAGGG - Intergenic
1184989876 22:48160129-48160151 ACTCTGTCACCCAGGCTGGATGG - Intergenic
1185009187 22:48303676-48303698 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1185273646 22:49940302-49940324 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
949178408 3:1095435-1095457 ACTCTGTCACCCAGGCTGGAGGG - Intronic
949273725 3:2253673-2253695 ACTCTGTCACCCAGGCTGGAGGG + Intronic
949482757 3:4509761-4509783 ACTCTGTCACCCAGGCTGGAAGG - Intronic
950087621 3:10271742-10271764 ACTCTGTCACCCAGGCTGGAGGG + Intronic
950188758 3:10961702-10961724 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
950382504 3:12628783-12628805 ACTCTGTTGGCCAGGCTAGAGGG + Intronic
950408984 3:12822326-12822348 ACTCTGTCACCCAGGCTGGAAGG + Intronic
950477367 3:13222656-13222678 ACGCTGGGGGCCAAGCTCGGTGG + Intergenic
950493900 3:13322360-13322382 AGGGTGTGGGCCAGGCCCGATGG + Intronic
950817347 3:15719902-15719924 ACTCTGTCACCCAGGCTGGAGGG + Intronic
951097418 3:18648171-18648193 ACTATATGAGCCAGGCTAGATGG - Intergenic
952463606 3:33556467-33556489 ACTCTGTCATCCAGGCTAGAGGG + Intronic
952483597 3:33787355-33787377 GCTCTGTCAGCCAGGCTGGAGGG + Intergenic
952813360 3:37424818-37424840 ACTCTGTCACCCAGGCTGGAGGG + Intronic
953431318 3:42842949-42842971 ACTCTGTCACCCAGGCTGGAGGG - Intronic
953473041 3:43182898-43182920 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
953656724 3:44860402-44860424 ACTCTGTCACCCAGGCTGGAGGG + Intronic
953683553 3:45058534-45058556 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
953858105 3:46517356-46517378 ACTCTGTCACCCAGGCTGGAGGG + Exonic
953950862 3:47189068-47189090 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
954592019 3:51791101-51791123 ACTCTGTCACCCAGGCTAGAGGG + Intergenic
954612039 3:51949696-51949718 ACCCTGTCACCCAGGCTAGAGGG + Intergenic
955302642 3:57797146-57797168 ACTCTGTCACCCAGGCTGGAGGG - Intronic
955369655 3:58340152-58340174 ACTCCGTCAGCCAGGCTGGAGGG + Intronic
955576379 3:60369004-60369026 ACTCTGTCACCCAGGCTGGAGGG + Intronic
955684259 3:61534416-61534438 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
955909918 3:63849352-63849374 ACTCTGTCACCCAGGCTAGAGGG - Intronic
955943714 3:64170839-64170861 ACTCTGTCACCCAGGCTGGAGGG - Intronic
956435898 3:69234209-69234231 ACTCTGTCACCCAGGCTGGAGGG - Intronic
956516220 3:70051099-70051121 ACTCTGTGGCCCAGGCTGGAGGG - Intergenic
956672879 3:71707920-71707942 ACTCTGTCACCCAGGCTGGAGGG + Intronic
956719153 3:72102806-72102828 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
956993298 3:74794490-74794512 TAGCTGTGAGCAAGGCTCCATGG - Intergenic
957137545 3:76308341-76308363 ACGCTGTCACCCAGGCTGGAGGG - Intronic
957216602 3:77328027-77328049 ACACTGTCACCCAGGCTGGAAGG - Intronic
958262266 3:91395620-91395642 ACTCTGTCACCCAGGCTAGAGGG + Intergenic
958444101 3:94194001-94194023 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
958925133 3:100149323-100149345 TGGCTGTGAGCCAGACTCCAAGG + Intronic
959470239 3:106741014-106741036 ACTCTGTCGGCCAGGCTGGAGGG - Intergenic
959806242 3:110557630-110557652 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
960866981 3:122211672-122211694 ACTCTGTTACCCAGGCTGGAGGG - Intronic
960900698 3:122551531-122551553 ACTCTGTCATCCAGGCTAGAGGG + Intronic
960965213 3:123099852-123099874 AGGCTGCCAGCCAGGCTTGATGG + Intronic
961033198 3:123624289-123624311 ATGCTGTCACCCAGGCTGGAGGG - Intronic
961242570 3:125424887-125424909 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
961246443 3:125458204-125458226 ACTCTGTCACCCAGGCTGGAGGG + Intronic
961957176 3:130816205-130816227 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
962527893 3:136252559-136252581 ACTCTGTCACCCAGGCTGGAGGG + Intronic
962528060 3:136253702-136253724 ACTCTGTCACCCAGGCTGGAGGG + Intronic
963125119 3:141808919-141808941 ACACTGTGAGCCAGGCATGGTGG + Intronic
963156936 3:142109360-142109382 TCGCTGTCACCCAGGCTAGAGGG + Intronic
963903561 3:150755362-150755384 ACTCTGTCACCCAGGCTGGAGGG + Intronic
964517243 3:157525396-157525418 ACTCTGTCACCCAGGCTGGAGGG - Intronic
964798596 3:160528397-160528419 ACTCTGTCATCCAGGCTGGAGGG + Intronic
965489484 3:169319062-169319084 ACTCTGTCACCCAGGCTGGAGGG - Intronic
965693475 3:171382252-171382274 GCTCTGTCAGCCAGGCTGGAGGG + Intronic
965800319 3:172485941-172485963 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
966117952 3:176487291-176487313 ACTCTGTCACCCAGGCTAGAGGG - Intergenic
966180354 3:177182349-177182371 ACTCTGTCACCCAGGCTGGAGGG - Intronic
966198312 3:177335575-177335597 ACTCTGTCATCCAGGCTGGAGGG - Intergenic
966324319 3:178737233-178737255 ACTCTGTCACCCAGGCTGGAGGG - Intronic
966601589 3:181780481-181780503 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
966767556 3:183477200-183477222 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
966817996 3:183904924-183904946 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
967042592 3:185707339-185707361 ACTCTGTCACCCAGGCTAGAGGG + Intronic
967052610 3:185798821-185798843 ACTCTGTCATCCAGGCTGGATGG + Intronic
967428447 3:189354496-189354518 ACTCTGTGACCCATGCTGGAGGG + Intergenic
967468161 3:189831861-189831883 ACTCTGTCACCCAGGCTGGAGGG + Intronic
967776288 3:193389311-193389333 ACTCTGTCACCCAGGCTAGAGGG - Intergenic
967874504 3:194257836-194257858 ACTCTGTTACCCAGGCTGGAGGG - Intergenic
968079910 3:195838672-195838694 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
968562720 4:1293355-1293377 ACTCTGTCACCCAGGCTGGAGGG - Intronic
968634369 4:1670386-1670408 AGGCTCTGAGCCAGGCTGGGTGG - Intronic
968635649 4:1677273-1677295 GCGCCATGAGCCAGGCTGGAAGG - Intronic
968708812 4:2097382-2097404 ACTCTGTCACCCAGGCTGGAGGG + Intronic
968794968 4:2697320-2697342 ACTCTGTCACCCAGGCTGGAGGG - Intronic
969090528 4:4690661-4690683 ACCCTGTCACCCAGGCTGGAGGG - Intergenic
969139348 4:5055121-5055143 ACTCTGTCACCCAGGCTGGAGGG + Intronic
969254380 4:5992418-5992440 ACCCCGAGATCCAGGCTCGACGG - Intergenic
969554549 4:7897556-7897578 ACTCTGTCACCCAGGCTGGAGGG + Intronic
970298703 4:14659166-14659188 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
970708950 4:18839280-18839302 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
970758587 4:19455770-19455792 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
970776661 4:19682708-19682730 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
970783266 4:19766000-19766022 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
970831305 4:20343533-20343555 ACTCTGTCACCCAGGCTGGAGGG + Intronic
970968516 4:21954431-21954453 ACTCTGTTACCCAGGCTGGAGGG - Intergenic
971284937 4:25279912-25279934 ACTCTGTCACCCAGGCTGGAAGG - Intergenic
971357481 4:25907991-25908013 ACTCTGTCACCCAGGCTGGAAGG - Intronic
971430855 4:26565752-26565774 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
971451557 4:26805935-26805957 ACTCTGTCATCCAGGCTGGAGGG - Intergenic
971684926 4:29751910-29751932 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
971790929 4:31168999-31169021 ACTCTGTTACCCAGGCTGGAAGG + Intergenic
972042929 4:34626510-34626532 ACTCTGTGGCCCAGGCTGGATGG + Intergenic
972561223 4:40230644-40230666 AGGCTGAGAGCCAGGCGCGGTGG - Intronic
972613263 4:40674848-40674870 ACTCTGTTACCCAGGCTGGAGGG + Intergenic
972633821 4:40864890-40864912 ACTCTGTCACCCAGGCTGGAGGG + Intronic
972673425 4:41236164-41236186 ACTCTGTGGCCCAGGCTGGAGGG + Intergenic
973093200 4:46164262-46164284 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
973196742 4:47452961-47452983 ACTCTGTCACCCAGGCTGGAGGG - Intronic
973216850 4:47679395-47679417 ACCCTGTCACCCAGGCTGGAGGG + Intronic
973559992 4:52125727-52125749 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
973952222 4:56027719-56027741 ACTCTGTCACCCAGGCTGGAAGG + Intronic
974847349 4:67367040-67367062 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
975132889 4:70846140-70846162 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
976056893 4:81079637-81079659 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
976247838 4:83021408-83021430 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
976260590 4:83141304-83141326 ACGCTGTTGCCCAGGCTGGAGGG - Intergenic
976828813 4:89290035-89290057 ACTCTGTCACCCAGGCTGGAGGG + Intronic
976931063 4:90567637-90567659 ACTCTGTCACCCAGGCTCTAGGG + Intronic
977329658 4:95621649-95621671 ACTCTGTCACCCAGGCTAGAGGG - Intergenic
977938705 4:102834713-102834735 ACTCTGTCATCCAGGCTGGAGGG - Intronic
978336051 4:107670570-107670592 ACTCTGTCATCCAGGCTGGAGGG + Intronic
978356237 4:107877947-107877969 ACTCTGTCACCCAGGCTGGAGGG + Intronic
978359969 4:107921047-107921069 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
978947846 4:114519518-114519540 AAACTTTGAGCCAGGCTAGAGGG + Intergenic
979014189 4:115411946-115411968 ACTCTGTCATCCAGGCTGGAGGG + Intergenic
979307089 4:119158520-119158542 ACTCTGTTACCCAGGCTGGATGG - Intronic
979930173 4:126619722-126619744 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
980031555 4:127837835-127837857 ACTCTGTCACCCAGGCTGGAGGG + Exonic
980039979 4:127928080-127928102 ACTCTGTCACCCAGGCTGGAGGG + Intronic
980137898 4:128877645-128877667 ACTCTGTCACCCAGGCTGGAGGG - Intronic
980470548 4:133245125-133245147 ACTCTGTGGCCCAGGCTGGAGGG - Intergenic
982124731 4:152174733-152174755 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
982326029 4:154128950-154128972 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
982457509 4:155628064-155628086 GCTCTGTGACCCAGGCTGGAGGG + Intergenic
982491042 4:156030132-156030154 ACTCTGTGGCCCAGGCTGGAGGG + Intergenic
982600331 4:157441436-157441458 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
982711469 4:158762342-158762364 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
982949304 4:161669076-161669098 ACTCTGTCACCCAGGCTGGAGGG - Intronic
983213800 4:164983879-164983901 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
983576004 4:169262631-169262653 ACTCTGTCACCCAGGCTGGAGGG - Intronic
983594210 4:169448191-169448213 ACTCTGTCACCCAGGCTGGAGGG - Intronic
983809272 4:172038082-172038104 ACTCTGTTAGCCACGCTGGAGGG - Intronic
983934538 4:173492094-173492116 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
983995227 4:174174522-174174544 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
984630941 4:182060201-182060223 ACTCTGTTACCCAGGCTGGAGGG - Intergenic
984907126 4:184638981-184639003 ACTCTGTCACCCAGGCTGGAGGG + Intronic
985114504 4:186577555-186577577 ACTCTGTAACCCAGGCTGGAGGG + Intergenic
985406275 4:189641602-189641624 ACTCTGTTGGCCAGGCTGGAGGG - Intergenic
1202770150 4_GL000008v2_random:196996-197018 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
985561051 5:586025-586047 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
985935573 5:3095177-3095199 ACACTGAGAGCCAGGCTGGTGGG - Intergenic
986139011 5:5012084-5012106 ACGCTGTCACCCAGGCTTGAGGG + Intergenic
986222351 5:5780214-5780236 ACACTGTTACCCAGGCTGGAGGG - Intergenic
987337303 5:16908199-16908221 ACTCTGTCACCCAGGCTGGATGG - Intronic
988276018 5:29081644-29081666 ACTCTGTCACCCAGGCTGGAAGG - Intergenic
988884963 5:35546705-35546727 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
989458586 5:41669923-41669945 ACTCTGTCACCCAGGCTGGAAGG - Intergenic
989594723 5:43145621-43145643 ACTCTGTCACCCAGGCTGGATGG - Intronic
990282552 5:54267123-54267145 ACTCTGTCACCCAGGCTGGAGGG + Intronic
990415988 5:55587243-55587265 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
990853920 5:60241305-60241327 ACTCTGTCACCCAGGCTGGAGGG + Intronic
991334238 5:65529519-65529541 ACTCTGTCACCCAGGCTGGAGGG + Intronic
991705650 5:69355495-69355517 TCGCTGTCACCCAGGCTGGAGGG - Intronic
991717410 5:69464649-69464671 ACTCTGTCACCCAGGCTAGAGGG - Intergenic
991944065 5:71882724-71882746 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
992060484 5:73039896-73039918 ACTCTGTCACCCAGGCTAGATGG - Intronic
992072236 5:73158782-73158804 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
992119462 5:73576136-73576158 ACTCTGTGGCCCAGGCTGGAGGG + Intronic
992221217 5:74575484-74575506 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
992417221 5:76563194-76563216 ACTCTGTCACCCAGGCTGGAGGG - Intronic
992438284 5:76775981-76776003 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
993916109 5:93743951-93743973 GGGCTGTTAGCCAGGCGCGATGG - Intronic
994414375 5:99449461-99449483 ACTCTGTCAACCAGGCTGGAGGG - Intergenic
994901755 5:105781671-105781693 ACTCTGTCCGCCAGGCTGGAGGG - Intergenic
995198020 5:109395491-109395513 ACTCTGTCACCCAGGCTGGAGGG - Intronic
995403770 5:111770598-111770620 ACTCTGTTACCCAGGCTGGATGG + Intronic
996515658 5:124366540-124366562 AAGCTGTGACCCAGGCTCAGGGG - Intergenic
996850815 5:127950010-127950032 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
996861447 5:128071733-128071755 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
996919426 5:128750319-128750341 AGGCTTTGAGCCAGGCACGAGGG + Intronic
997943192 5:138177051-138177073 ACTCTGTGGCCCAGGCTGGAGGG - Intronic
998262677 5:140643224-140643246 ACTCTGTCACCCAGGCTGGATGG + Intronic
998434540 5:142096326-142096348 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
998451647 5:142239126-142239148 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
998495807 5:142588290-142588312 ACTCTGTCACCCAGGCTAGAGGG - Intergenic
998654311 5:144159736-144159758 ACCCTGTCACCCAGGCTGGATGG + Exonic
999214790 5:149923462-149923484 ACTCTGTCACCCAGGCTGGAGGG - Intronic
999235818 5:150093110-150093132 ACTCTGTCACCCAGGCTGGAGGG + Intronic
999401992 5:151272039-151272061 ACTCTGTCACCCAGGCTAGAGGG - Intergenic
999823991 5:155256676-155256698 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
999984750 5:156992367-156992389 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1000201169 5:159012514-159012536 ACTCTGTCACCCAGGCTGGATGG + Intronic
1000831433 5:166106236-166106258 ACTCTGTCACCCAGGCTGGATGG - Intergenic
1001805010 5:174576534-174576556 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1001921496 5:175603664-175603686 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1002078162 5:176721913-176721935 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1002119073 5:176987615-176987637 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1002124052 5:177028528-177028550 AAGCTGTGAGCCAGGAACTATGG - Intronic
1002175849 5:177400650-177400672 GCGCTGTGAGGCAGGCTGGGCGG + Intergenic
1002313817 5:178330618-178330640 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1002610312 5:180413488-180413510 ACGCTGTGAGACTGCCTGGAGGG - Intergenic
1003421039 6:5958883-5958905 TCGCTGTCACCCAGGCTGGAGGG - Intergenic
1003580657 6:7337291-7337313 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1004062728 6:12213799-12213821 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1004104975 6:12659267-12659289 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1004184345 6:13409049-13409071 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1004220918 6:13745498-13745520 GCTCTGTCAGCCAGGCTAGACGG - Intergenic
1004232980 6:13849736-13849758 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1004362477 6:14983531-14983553 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1004898063 6:20168429-20168451 ACTCTGTGGCCCAGGCTGGAGGG - Intronic
1005246820 6:23895666-23895688 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1005644989 6:27829510-27829532 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1005718894 6:28581302-28581324 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1006528749 6:34631359-34631381 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1006642417 6:35496229-35496251 GCGCTGTGAGCTTGGCTCGGAGG - Intronic
1006947824 6:37797223-37797245 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1007023338 6:38544637-38544659 AGGGTGTGGGCCAGGCTCGGTGG + Intronic
1007575856 6:42924935-42924957 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1007659200 6:43472323-43472345 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1008454234 6:51690236-51690258 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1008682004 6:53882312-53882334 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1008993157 6:57627244-57627266 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1009737421 6:67694326-67694348 ACTCTGTCACCCAGGCTAGAGGG - Intergenic
1010239113 6:73600540-73600562 ACTCTGTGGCCCAGGCTTGAGGG + Intronic
1010423086 6:75696509-75696531 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1011279605 6:85663590-85663612 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1011606148 6:89107704-89107726 ACTCTGTCACCCAGGCTGGATGG - Intronic
1011687370 6:89834378-89834400 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1011727657 6:90226725-90226747 ACTCTGTCATCCAGGCTGGAGGG + Intronic
1011754653 6:90486406-90486428 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1012324662 6:97901230-97901252 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1012608606 6:101188504-101188526 TAGCAGTGAGCCAGGCTCCATGG - Intergenic
1013189288 6:107788699-107788721 AAGCTGTGAGCCAGGGAGGAAGG + Intronic
1013267137 6:108511052-108511074 ACTCTGTCACCCAGGCTGGAAGG - Intronic
1013414855 6:109916033-109916055 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1013493983 6:110679280-110679302 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1013522796 6:110948102-110948124 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1014220038 6:118790643-118790665 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1014436838 6:121430021-121430043 ACTCTGTGGCCCAGGCTGGAGGG + Intergenic
1015146396 6:129992359-129992381 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1015195719 6:130523135-130523157 ACTCTGTCACCCAGGCTAGATGG + Intergenic
1015290761 6:131536034-131536056 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1015836007 6:137420706-137420728 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1016163107 6:140906858-140906880 ACTCTGTCTGCCAGGCTGGAGGG + Intergenic
1016924958 6:149335398-149335420 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1016959570 6:149659423-149659445 ACTCTGTCACCCAGGCTGGAGGG - Exonic
1017367115 6:153655968-153655990 GCTCTGTCAGCCAGGCTGGAGGG - Intergenic
1017391997 6:153950328-153950350 ACTCTGTCACCCAGGCTGGAAGG - Intergenic
1017436792 6:154423296-154423318 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1017463316 6:154671642-154671664 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1018978060 6:168580573-168580595 ACTCTGTCATCCAGGCTGGAGGG + Intronic
1019037531 6:169074031-169074053 ACTCTGTCACCCAGGCTGGATGG + Intergenic
1019690896 7:2411106-2411128 ACTCTGTCATCCAGGCTGGAGGG + Intronic
1019961382 7:4462778-4462800 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1020135615 7:5586346-5586368 ACTCTGTTACCCAGGCTGGAGGG - Intergenic
1020187099 7:5967720-5967742 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1020295818 7:6757052-6757074 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1020966703 7:14878713-14878735 ACGCTGTTGCCCAGGCTGGAGGG - Intronic
1021108922 7:16671895-16671917 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1021691879 7:23238643-23238665 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1021727705 7:23565537-23565559 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1021742015 7:23696528-23696550 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1022212698 7:28227183-28227205 ACACTCTGGGCCAGGCGCGATGG - Intergenic
1022946957 7:35295561-35295583 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1022966645 7:35480581-35480603 ACTCTGTCATCCAGGCTGGAGGG - Intergenic
1023289890 7:38657827-38657849 ACTCTGTCATCCAGGCTGGAGGG + Intergenic
1023605472 7:41927175-41927197 ACTCTGTCACCCAGGCTGGATGG - Intergenic
1023807107 7:43880474-43880496 ACTCTGTCACCCAGGCTGGAAGG + Intronic
1023925856 7:44669184-44669206 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1024959792 7:54961851-54961873 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1025056573 7:55770199-55770221 ACTCTGTCACCCAGGCTAGAGGG + Intergenic
1025595952 7:62925973-62925995 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1025719608 7:63998156-63998178 ACTCTGTCATCCAGGCTGGAAGG + Intergenic
1025898711 7:65726538-65726560 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1025990222 7:66491883-66491905 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1026038572 7:66846962-66846984 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1026158612 7:67849417-67849439 ATTCTGTGTGCCAGGCTCCAGGG - Intergenic
1026251927 7:68678828-68678850 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1026290823 7:69004114-69004136 ACTCTGTCACCCAGGCTAGAGGG - Intergenic
1026818379 7:73529920-73529942 ACTCTGTCATCCAGGCTAGAGGG - Intergenic
1027155720 7:75766322-75766344 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1027157355 7:75778253-75778275 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1027212821 7:76164593-76164615 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1027418826 7:78000031-78000053 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1027805907 7:82822236-82822258 ATGCTATGAGCCAGGTTGGATGG + Intronic
1028203464 7:87989884-87989906 ACTCTGTCACCCAGGCTGGATGG - Intronic
1028593534 7:92524299-92524321 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1029187480 7:98749710-98749732 ACTCTGTCAACCAGGCTGGAGGG - Intergenic
1029239411 7:99148623-99148645 ACTCTGTCACCCAGGCTGGAAGG + Intergenic
1029246204 7:99203742-99203764 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1029387756 7:100254943-100254965 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1029644121 7:101841589-101841611 ACTCTGTCACCCAGGCTGGAAGG + Intronic
1029670119 7:102024358-102024380 ACTCTGTCACCCAGGCTAGAGGG + Intronic
1030116644 7:106066596-106066618 ACAGTGTGAGCCAGGCTAGGAGG + Intergenic
1030171442 7:106606872-106606894 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1030330349 7:108263692-108263714 AGCCTGTGAGCCAGGCTCTGTGG - Intronic
1031083592 7:117281269-117281291 ACTCTGTCACCCAGGCTTGAGGG + Intronic
1031596309 7:123653636-123653658 TCGCTGTCACCCAGGCTGGAGGG + Intergenic
1031928224 7:127658279-127658301 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1032107076 7:129041326-129041348 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1032330198 7:130971586-130971608 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1032563647 7:132917823-132917845 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1033786743 7:144740684-144740706 ACACTGTTACCCAGGCTGGAGGG - Intronic
1034094834 7:148397748-148397770 ATGATGTGAGCCAGGCACCAGGG + Intronic
1034135185 7:148761475-148761497 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1034195707 7:149245485-149245507 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1034568679 7:151936824-151936846 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1035734674 8:1879584-1879606 ACTCTGTCTGCCAGGCTGGAGGG + Intronic
1036118920 8:5993128-5993150 ACTCTGTCACCCAGGCTGGAAGG + Intergenic
1036122929 8:6037572-6037594 ACTCTGTCATCCAGGCTGGAGGG - Intergenic
1036407656 8:8469392-8469414 ACTCTGTCACCCAGGCTAGAGGG - Intergenic
1036410707 8:8497750-8497772 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1036470142 8:9045708-9045730 ACTCTGTCACCCAGGCTAGAGGG + Intronic
1036938493 8:13028607-13028629 ACTCTGTCACCCAGGCTGGAGGG + Exonic
1037084237 8:14827268-14827290 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1037294301 8:17384375-17384397 ACTCTGTCATCCAGGCTGGAAGG - Intronic
1037317646 8:17613823-17613845 ACTCTGTTACCCAGGCTGGAGGG - Intronic
1037336274 8:17795671-17795693 ACTCTGTCACCCAGGCTAGAGGG + Intronic
1037336326 8:17795981-17796003 ACTCTGTTGGCCAGGCTGGAGGG + Intronic
1037445451 8:18961056-18961078 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1037525251 8:19718124-19718146 ATGCTGTCACCCAGGCTGGAAGG + Intronic
1037984032 8:23275642-23275664 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1038224345 8:25642019-25642041 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1038316756 8:26490883-26490905 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1038339564 8:26674028-26674050 ACTCTGTCATCCAGGCTGGAGGG + Intergenic
1038486833 8:27941858-27941880 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1039073679 8:33669460-33669482 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1039997117 8:42542944-42542966 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1040001642 8:42582021-42582043 ACCCTGTGTCCTAGGCTCGATGG + Intergenic
1040365560 8:46711574-46711596 ACTCTGTCACCCAGGCTGGATGG + Intergenic
1041081028 8:54215013-54215035 ACTCTGTCATCCAGGCTGGAGGG - Intergenic
1041689506 8:60675304-60675326 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1041907546 8:63050375-63050397 ACTCTGTCAACCAGGCTGGATGG + Intronic
1042133177 8:65609569-65609591 AAGCTGTGGGCCAGGCGCCATGG + Intronic
1042186914 8:66145692-66145714 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1042211990 8:66390085-66390107 TCGCTGTCACCCAGGCTGGATGG - Intergenic
1042485998 8:69346243-69346265 ACTCTGTCATCCAGGCTGGAGGG - Intergenic
1043020222 8:74991024-74991046 ACTCTGTCAGCCAGGCTGAAGGG + Intronic
1043423656 8:80126513-80126535 ACTCTGTTACCCAGGCTGGAGGG + Intronic
1043439230 8:80262069-80262091 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1043650662 8:82586894-82586916 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1043857807 8:85281544-85281566 ACTCTGTCACCCAGGCTGGAGGG + Exonic
1045228299 8:100273814-100273836 ACTCTGTCATCCAGGCTGGAGGG + Intronic
1045493695 8:102690083-102690105 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1045558115 8:103234525-103234547 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1046113404 8:109754771-109754793 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1046461471 8:114542542-114542564 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1046732405 8:117739706-117739728 ACTCTGTTATCCAGGCTGGAGGG + Intergenic
1046809433 8:118516666-118516688 ACTCTGTCACCCAGGCTGGATGG + Intronic
1046820536 8:118629736-118629758 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1046909542 8:119610867-119610889 ACTCTGTCATCCAGGCTGGAGGG - Intronic
1047041614 8:121003147-121003169 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1047111165 8:121790995-121791017 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1047189925 8:122669153-122669175 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1047427456 8:124759728-124759750 ACACTGTCACCCAGGCTGGAGGG + Intergenic
1047993575 8:130312241-130312263 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1048882123 8:138879655-138879677 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1049055465 8:140233236-140233258 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1049103295 8:140594773-140594795 ACTGTGTCAGCCAGGCTGGAGGG - Intronic
1049323309 8:142009018-142009040 GCGCTCTGTGCCAGCCTCGAGGG + Intergenic
1049631301 8:143659531-143659553 ACTCTGTTACCCAGGCTAGAGGG + Intergenic
1049638637 8:143703951-143703973 ACTCTGTTACCCAGGCTGGAGGG + Intronic
1049775728 8:144403584-144403606 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1050133999 9:2442306-2442328 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1050185853 9:2972811-2972833 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1050326775 9:4505688-4505710 ACACTGTTACCCAGGCTGGAGGG + Intronic
1050510849 9:6393635-6393657 ACTCTGTCACCCAGGCTGGAAGG - Intergenic
1051266630 9:15315635-15315657 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1051289160 9:15527910-15527932 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1051610207 9:18954368-18954390 ACTCTGTCATCCAGGCTGGAGGG + Intronic
1051660711 9:19423673-19423695 ACTCTGTCACCCAGGCTGGAAGG - Intronic
1051820155 9:21155651-21155673 ACGCTGTTCCCCAGGCTGGATGG + Intergenic
1051829494 9:21259490-21259512 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1051899046 9:22018617-22018639 GCGCTGTCACCCAGGCTGGACGG - Intronic
1052825925 9:33174613-33174635 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1053726766 9:41011206-41011228 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1054359200 9:64096935-64096957 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1054702970 9:68432637-68432659 ACTCTGTTACCCAGGCTGGAGGG + Intronic
1054752143 9:68918121-68918143 ACTCTGTCACCCAGGCTAGAGGG + Intronic
1054798132 9:69321553-69321575 AGGCTGGGAGCCAGGCTCCTGGG + Intergenic
1054913317 9:70473851-70473873 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1054913912 9:70478756-70478778 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1054920700 9:70539866-70539888 ACTCTGTCACCCAGGCTGGAAGG + Intronic
1055058559 9:72046049-72046071 ACTCTGTCACCCAGGCTGGATGG + Intergenic
1055473640 9:76639455-76639477 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1055532905 9:77204658-77204680 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1055835007 9:80429458-80429480 ACTCTGTCATCCAGGCTGGAGGG - Intergenic
1056638429 9:88350039-88350061 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1056780805 9:89548901-89548923 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1056986242 9:91365868-91365890 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1057885831 9:98828861-98828883 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1058030182 9:100187558-100187580 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1058101489 9:100922217-100922239 AACCTGTCAGCCAGGCACGATGG - Intergenic
1058276892 9:103054435-103054457 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1058683924 9:107464513-107464535 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1058961784 9:109998731-109998753 TCGCTGTCACCCAGGCTGGACGG - Intronic
1059950128 9:119453858-119453880 ACTCTGTTACCCAGGCTGGAGGG - Intergenic
1060248760 9:121968901-121968923 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1060280203 9:122210593-122210615 ACTCTGTCACCCAGGCTAGAGGG + Intronic
1060967409 9:127719524-127719546 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1061072425 9:128319455-128319477 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1061254246 9:129444839-129444861 ACTCTGTCACCCAGGCTAGAGGG + Intergenic
1061292313 9:129657865-129657887 ACTCTGTTACCCAGGCTGGAAGG - Intergenic
1061351137 9:130065731-130065753 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1061686283 9:132282329-132282351 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1061782005 9:133001684-133001706 ACTCTGTCACCCAGGCTGGATGG - Intergenic
1062654498 9:137595903-137595925 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1203695051 Un_GL000214v1:90673-90695 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1203448546 Un_GL000219v1:86060-86082 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1203704495 Un_KI270742v1:26760-26782 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1203559506 Un_KI270744v1:39052-39074 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1203641222 Un_KI270751v1:13390-13412 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1203657362 Un_KI270753v1:11016-11038 ACTCTGTTGGCCAGGCTGGAGGG - Intergenic
1185532819 X:835249-835271 ACTCTGTGGCCCAGGCTGGAGGG + Intergenic
1185588625 X:1259040-1259062 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1185599229 X:1327612-1327634 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1185622541 X:1461540-1461562 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1185824742 X:3239469-3239491 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1186661284 X:11669972-11669994 ACTCTGTGGCCCAGGCTGGAGGG + Intergenic
1187262971 X:17704328-17704350 ACTCTGTCACCCAGGCTGGATGG + Intronic
1187276539 X:17820931-17820953 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1187507188 X:19887392-19887414 GCGCTGGGATCCAGGCGCGAGGG + Exonic
1187703359 X:21985985-21986007 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1188007784 X:25028594-25028616 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1188347136 X:29080774-29080796 ACTCTGTCATCCAGGCTGGAGGG + Intronic
1189807781 X:44752623-44752645 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1190048748 X:47133409-47133431 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1190052888 X:47164486-47164508 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1190239312 X:48644942-48644964 ACTCTGTAATCCAGGCTGGAGGG + Intergenic
1190422880 X:50303177-50303199 ACTCTGTCACCCAGGCTAGAAGG + Intronic
1190478998 X:50856475-50856497 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1190772703 X:53528317-53528339 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1190848201 X:54214008-54214030 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1192069416 X:67921185-67921207 ACTCTGTGGGCCAGGCTGGAGGG - Intergenic
1192124942 X:68493251-68493273 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1192125813 X:68499669-68499691 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1192601600 X:72470112-72470134 ACTCTGTGGCCCAGGCTGGAGGG - Intronic
1192625669 X:72725471-72725493 TCGCTGTTGGCCAGGCTGGAGGG + Intergenic
1192818581 X:74619331-74619353 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1192978871 X:76317810-76317832 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1193379377 X:80801251-80801273 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1193651048 X:84132414-84132436 ACTCTGTCACCCAGGCTGGAGGG - Intronic
1194895849 X:99438277-99438299 ACACTGTCACCCAGGCTGGAGGG - Intergenic
1194950065 X:100115124-100115146 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1195605909 X:106805114-106805136 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1196388965 X:115189940-115189962 ACGCTGTGAGCCAGGCTCGACGG - Exonic
1196829903 X:119767668-119767690 ACTCTGTCATCCAGGCTGGAGGG + Intergenic
1196873635 X:120136733-120136755 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1197189086 X:123625123-123625145 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1197555479 X:127947361-127947383 ACACTGTGAGCCTGCCTCCAGGG + Intergenic
1197920373 X:131586494-131586516 ACTCTGTGGCCCAGGCTGGAAGG + Intergenic
1198042081 X:132863351-132863373 ACGCTGTTGCCCAGGCTCAAGGG + Intronic
1198064613 X:133084230-133084252 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1198175788 X:134153165-134153187 ACTCTGTGGCCCAGGCTGGAGGG + Intergenic
1198320028 X:135511357-135511379 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1198467920 X:136920329-136920351 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1198814761 X:140577711-140577733 ACACTGTGGGCCAGGCGTGATGG - Intergenic
1199879433 X:151961497-151961519 ACTCTGTCACCCAGGCTGGAGGG + Intronic
1200090469 X:153633601-153633623 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1200618177 Y:5407624-5407646 AAGCTGTGGGCCAGGCACGGTGG + Intronic
1200800037 Y:7378098-7378120 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1200886004 Y:8270608-8270630 ACACTGTGAGCCAGTGTGGAAGG + Intergenic
1200952454 Y:8912748-8912770 ACACTGTGAGCCAGTGTGGAAGG - Intergenic
1201052808 Y:9956380-9956402 ACACTGTGAGCCAGTGTGGAAGG - Intergenic
1201181526 Y:11352258-11352280 GCTCTGTCAGCCAGGCTAGAGGG - Intergenic
1201254570 Y:12094138-12094160 ACTCTGTCATCCAGGCTAGAGGG - Intergenic
1201678831 Y:16619688-16619710 ACTCTGTCACCCAGGCTGGAGGG - Intergenic
1201714658 Y:17031276-17031298 ACTCTGTCACCCAGGCTGGAGGG + Intergenic
1202112208 Y:21434017-21434039 ACACTGTGAGCCAGTGTAGAAGG + Intergenic
1202188467 Y:22215030-22215052 ACACTGTGAGCCAGTGTGGAAGG - Intergenic
1202198135 Y:22317396-22317418 ACACTGTGAGCCAGTGTGGAAGG - Intronic
1202603682 Y:26620255-26620277 ACTCTGTCACCCAGGCTGGAGGG - Intergenic