ID: 1196388972

View in Genome Browser
Species Human (GRCh38)
Location X:115189978-115190000
Sequence CGGGAAGGCACCGACTGTGT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 56}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196388967_1196388972 7 Left 1196388967 X:115189948-115189970 CCTGGCTCACAGCGTTGGCTGTG 0: 1
1: 0
2: 2
3: 9
4: 175
Right 1196388972 X:115189978-115190000 CGGGAAGGCACCGACTGTGTCGG 0: 1
1: 0
2: 0
3: 1
4: 56
1196388965_1196388972 15 Left 1196388965 X:115189940-115189962 CCGTCGAGCCTGGCTCACAGCGT 0: 1
1: 0
2: 1
3: 27
4: 1136
Right 1196388972 X:115189978-115190000 CGGGAAGGCACCGACTGTGTCGG 0: 1
1: 0
2: 0
3: 1
4: 56
1196388964_1196388972 20 Left 1196388964 X:115189935-115189957 CCACGCCGTCGAGCCTGGCTCAC 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1196388972 X:115189978-115190000 CGGGAAGGCACCGACTGTGTCGG 0: 1
1: 0
2: 0
3: 1
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196388972 Original CRISPR CGGGAAGGCACCGACTGTGT CGG Exonic
900558510 1:3291936-3291958 GGAGAAGGCACCTGCTGTGTGGG - Intronic
913251137 1:116912601-116912623 CAGGAAGACACCAACTGTGTGGG - Intronic
914917964 1:151829948-151829970 TGTGAAGGCAGGGACTGTGTTGG + Intronic
918043368 1:180926671-180926693 CCGGAAGGCTCCGAGTGTGCGGG + Intronic
920265037 1:204715434-204715456 TGGGAAGGGAGCGTCTGTGTGGG + Intergenic
1067987587 10:51167199-51167221 CGTGGAGGCAATGACTGTGTGGG + Intronic
1077289308 11:1781602-1781624 CAGGAGGGCACTGCCTGTGTGGG - Intergenic
1080810805 11:35702296-35702318 CGGGAGGGCAGCGAGGGTGTGGG + Intronic
1083663739 11:64263877-64263899 CTGGATGGCCCCGACTGAGTAGG + Intronic
1084205143 11:67586746-67586768 CAGGAAGCCACTGACTGTGCTGG - Intergenic
1089377658 11:118005939-118005961 ACGGGAGGCACCGACTGTATGGG + Intergenic
1091222930 11:133940933-133940955 CGGGCAGGCAGGGGCTGTGTCGG - Intronic
1124232556 15:27957805-27957827 CTGTCAGGCATCGACTGTGTGGG - Intronic
1132021724 15:98368337-98368359 CGGGAAGGAAGTGACTGAGTGGG - Intergenic
1132747180 16:1441671-1441693 CGGGCAGGCGCTGGCTGTGTGGG + Intronic
1134192653 16:12134534-12134556 TGGGAAGTCAGCTACTGTGTTGG - Intronic
1146842627 17:36166359-36166381 CGGGAAGACACCTACCCTGTGGG - Exonic
1146854939 17:36254318-36254340 CGGGAAGACACCTACCCTGTGGG - Exonic
1146865681 17:36334058-36334080 CGGGAAGACACCTACCCTGTGGG + Exonic
1146870839 17:36378210-36378232 CGGGAAGACACCTACCCTGTGGG - Exonic
1146878198 17:36429292-36429314 CGGGAAGACACCTACCCTGTGGG - Exonic
1146882147 17:36450438-36450460 CGGGAAGACACCTACCCTGTGGG - Intergenic
1147068550 17:37934670-37934692 CGGGAAGACACCTACCCTGTGGG + Exonic
1147073723 17:37978834-37978856 CGGGAAGACACCTACCCTGTGGG - Intronic
1147080073 17:38014207-38014229 CGGGAAGACACCTACCCTGTGGG + Intronic
1147085244 17:38058372-38058394 CGGGAAGACACCTACCCTGTGGG - Exonic
1147096022 17:38138167-38138189 CGGGAAGACACCTACCCTGTGGG + Intergenic
1147101191 17:38182338-38182360 CGGGAAGACACCTACCCTGTGGG - Intergenic
1148080706 17:44966624-44966646 CTGGAAAGCACTGAGTGTGTCGG - Intronic
1148683090 17:49485901-49485923 CGGGAAGCCACCGACTCAGCTGG - Intergenic
1149845789 17:60008844-60008866 CGGGAAGACACCTACCCTGTGGG - Intergenic
1150084137 17:62265424-62265446 CGGGAAGACACCTACCCTGTGGG - Intergenic
1154007619 18:10545923-10545945 GGGGAAGGCACCGAGTGCCTTGG + Intronic
1166979893 19:46626076-46626098 TGGGAAGCCACCGACTCCGTGGG - Intergenic
1168426574 19:56244106-56244128 GGGGAAGCCACAGACTGTGGCGG - Intronic
928986787 2:37189883-37189905 CTGGAAGGCAGATACTGTGTTGG + Intronic
937994129 2:127680168-127680190 CGGGAGGGCTCCGGCTGTGCAGG - Intronic
948454352 2:238097850-238097872 GGGTAAGGCACTGTCTGTGTCGG + Intronic
1173927196 20:46789630-46789652 GGGGCAGCCACAGACTGTGTAGG - Intergenic
1175828407 20:61949545-61949567 CTGGATGGCACCATCTGTGTGGG - Intergenic
1183809149 22:40239293-40239315 CCGGAAGGCACAGACTGACTTGG - Intronic
950243127 3:11389560-11389582 CGGGAAAATACCGCCTGTGTGGG + Intronic
961594755 3:128007204-128007226 CTGGAAGGCAGTCACTGTGTGGG - Intergenic
968489067 4:880526-880548 CTGGAAGGCACAGTCTCTGTGGG - Intronic
970962159 4:21884825-21884847 AGGGAAGGCAGTGACTGTGGTGG - Intronic
972552192 4:40144182-40144204 CGGGCAGGCACCAACCATGTGGG - Intronic
982692808 4:158567199-158567221 CGGGGAGGCTCCGGCTGTGCAGG - Intronic
1002872881 6:1183275-1183297 CAGGAAGATACCTACTGTGTTGG + Intergenic
1016986649 6:149900468-149900490 CTGGGAGGCACCGGCTGTGAAGG - Intergenic
1017882686 6:158572787-158572809 CGGCAAGGCAGCGTCCGTGTTGG + Intronic
1030772182 7:113488196-113488218 CGGGGAGGCTCAGGCTGTGTGGG + Intergenic
1051174232 9:14347302-14347324 CCCGAAGGCACTGACTGTGCAGG - Intronic
1055954059 9:81757561-81757583 GGGGAAGGCTCTGACTGTGCTGG + Intergenic
1061716305 9:132520686-132520708 GGGGAAGGCACTGACTGAGAAGG - Intronic
1186516142 X:10167225-10167247 CAGGAAGGCACTGACAGTGACGG - Intronic
1192139673 X:68637040-68637062 CAGGAGGGCAGAGACTGTGTTGG + Intergenic
1196388972 X:115189978-115190000 CGGGAAGGCACCGACTGTGTCGG + Exonic
1196389006 X:115190107-115190129 TGGGAAGGCCCCGGCCGTGTGGG + Exonic