ID: 1196389006

View in Genome Browser
Species Human (GRCh38)
Location X:115190107-115190129
Sequence TGGGAAGGCCCCGGCCGTGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 127}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196388994_1196389006 17 Left 1196388994 X:115190067-115190089 CCCGGTCAAGCCTGGCTCGCATT 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1196389006 X:115190107-115190129 TGGGAAGGCCCCGGCCGTGTGGG 0: 1
1: 0
2: 0
3: 8
4: 127
1196388998_1196389006 7 Left 1196388998 X:115190077-115190099 CCTGGCTCGCATTGGCGGCAGTG 0: 1
1: 0
2: 0
3: 4
4: 57
Right 1196389006 X:115190107-115190129 TGGGAAGGCCCCGGCCGTGTGGG 0: 1
1: 0
2: 0
3: 8
4: 127
1196388995_1196389006 16 Left 1196388995 X:115190068-115190090 CCGGTCAAGCCTGGCTCGCATTG 0: 1
1: 0
2: 0
3: 3
4: 85
Right 1196389006 X:115190107-115190129 TGGGAAGGCCCCGGCCGTGTGGG 0: 1
1: 0
2: 0
3: 8
4: 127
1196388993_1196389006 18 Left 1196388993 X:115190066-115190088 CCCCGGTCAAGCCTGGCTCGCAT 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1196389006 X:115190107-115190129 TGGGAAGGCCCCGGCCGTGTGGG 0: 1
1: 0
2: 0
3: 8
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196389006 Original CRISPR TGGGAAGGCCCCGGCCGTGT GGG Exonic
900134139 1:1107060-1107082 TGGGGAGGCTCGGGCTGTGTGGG - Intronic
900414587 1:2529172-2529194 TGGGAAGTCCCCGGCCGCCCGGG - Exonic
900777685 1:4596790-4596812 TGGGAGGGGCCCGGCCTTGTTGG - Intergenic
901190529 1:7407400-7407422 TGGGAAGGGCCCTGCTCTGTGGG + Intronic
904445497 1:30570362-30570384 TGGGGAGGGCCCGGCCGAGTTGG + Intergenic
913987136 1:143575352-143575374 TGGGGAGGCTCAGGCCGTGCAGG - Intergenic
920232622 1:204480665-204480687 TGGGCAGGGCCAGGCTGTGTGGG + Intronic
1066613569 10:37275389-37275411 TGGGAAGGCTCAGGCCGCATGGG + Intronic
1069172876 10:65254940-65254962 TGGTCAGGCCCCGGCAGTGATGG - Intergenic
1069714298 10:70510631-70510653 TGGGAGGGACCCTGCCCTGTTGG - Intronic
1072471362 10:95717041-95717063 TGGGTAGGCATGGGCCGTGTGGG + Intronic
1074476228 10:113777134-113777156 TGGGAAGGCCCCCCACGTTTGGG + Exonic
1076842439 10:133052421-133052443 TGGGAAGCCCCCAGCAGCGTGGG + Intergenic
1076861727 10:133141083-133141105 TGGGGAGGCCCCAGCCTTGCAGG - Intergenic
1077374561 11:2199471-2199493 TGGGAAGGCCCAGGCTGAGGAGG - Intergenic
1077962470 11:7089654-7089676 CGGGAGGGCCCTGGCCGTGCGGG + Exonic
1078509357 11:11974062-11974084 GGGGAAGGCCCTGGCCCTGGAGG - Intronic
1079726178 11:23883494-23883516 TGGGGAGGCTCCGGCCGTACAGG + Intergenic
1081646658 11:44795083-44795105 TGGGAAGACCCCGGGGGTGGGGG - Intronic
1082160510 11:48883779-48883801 TGGGAGGGGCACGGCGGTGTAGG - Intergenic
1082161856 11:48896627-48896649 TGGGAGGGGCACGGCGGTGTAGG + Intergenic
1082167441 11:48965072-48965094 TGGGAGGGGCACGGCGGTGTAGG + Intergenic
1082242575 11:49888218-49888240 TGGGAGGGGCACGGCGGTGTAGG + Intergenic
1082657060 11:55869021-55869043 TGGGAGGGGCACGGCAGTGTAGG + Intergenic
1083828017 11:65214016-65214038 TGGCAGGGCCCCGGCAGTGGTGG - Intergenic
1090484343 11:127099095-127099117 TGGGGAGGCCCCCGAGGTGTAGG + Intergenic
1092545814 12:9450471-9450493 CGGGCAGGCTCCGGCCGCGTAGG + Intergenic
1094507140 12:31071602-31071624 CGGGGAGGCTCCGGCCGCGTAGG - Intergenic
1095447773 12:42299708-42299730 TGGGAGGGCCCTGACCATGTTGG - Intronic
1103247629 12:119471682-119471704 TGGGAAGGCTCCTGCCCTGCAGG + Intronic
1104198796 12:126567338-126567360 CGGGAAGGCTCAGGCCGTGCAGG - Intergenic
1106505061 13:30364041-30364063 TGGGAAGGCTCTAGACGTGTGGG - Intergenic
1111886449 13:94027779-94027801 TGGGAAGCCCCCGACAGTATGGG - Exonic
1113412760 13:110104938-110104960 TGGGAAGGAGCAGGCTGTGTCGG - Intergenic
1113552259 13:111201796-111201818 TGGGAAGGACACGGCGGTGCTGG - Intronic
1118572548 14:67208020-67208042 TGGGAGAGCCCCGGGTGTGTTGG - Intronic
1118742448 14:68749620-68749642 AGTGAAGGCGCCGGCAGTGTTGG - Intergenic
1121307930 14:92918466-92918488 AGGCAAGGCCCCTGCCTTGTTGG - Intergenic
1121655905 14:95595343-95595365 GGGGAAGGAGCAGGCCGTGTAGG - Intergenic
1122131164 14:99605001-99605023 TGGCAAGGCCCTGGCCCTGCAGG - Intergenic
1122874407 14:104656905-104656927 TTGGAAGGCCACAGCCCTGTTGG - Intergenic
1124145773 15:27123962-27123984 AGGGAAGGCTCCGGCCGCCTGGG - Intronic
1126775345 15:52095315-52095337 TGGGAAGGGCCCGTCCCGGTTGG + Intergenic
1131012670 15:89031762-89031784 AGGGGAGGCTCCGGCCGTGCAGG + Intergenic
1132419527 15:101652996-101653018 GGGGAAGGTCGCGGCCGTCTGGG + Intergenic
1132483999 16:180902-180924 CGGGAGGGCCCCGGCGGGGTGGG + Intronic
1133349710 16:5093363-5093385 TGGGGAGGCCCCTGCCATGCTGG + Intronic
1135762016 16:25145375-25145397 TGGGAAGGCCCCCACCTTTTTGG - Intronic
1141800405 16:86304141-86304163 GGGCGAGGCCCCGGCCGTGTGGG + Intergenic
1141900716 16:86988601-86988623 AGCGAAGGCCCAGGCCTTGTGGG - Intergenic
1142478689 17:204854-204876 TGGGCAGGCCCCTGCTGTGGGGG + Intergenic
1150682548 17:67295008-67295030 TGGGAAGGCTCCAGCCGCGCAGG - Intergenic
1151840601 17:76614980-76615002 TGGGGAGGCTCGGGCCCTGTGGG + Intergenic
1152029005 17:77830315-77830337 TCAGAAGGCCCAGGCCTTGTTGG + Intergenic
1152664402 17:81558976-81558998 TGACAAGTCCCCCGCCGTGTTGG - Exonic
1152687515 17:81701858-81701880 GGGGAAGCCCCCAGCCCTGTGGG + Exonic
1153665086 18:7360934-7360956 TGGGGAGGCTCCAGCCGTGCAGG - Intergenic
1157377028 18:47176341-47176363 TAGGAAGGCGCCGGCCGTGGAGG - Intergenic
1160598213 18:79992454-79992476 TGGGAAGGCCCTGGGCCTGGGGG - Intronic
1162545298 19:11325436-11325458 CGGGAAAGGCCCGGCCGTGGGGG - Exonic
1162793318 19:13074067-13074089 TGGGACGGCCCTGGCCCTGGGGG - Intronic
1163188488 19:15658372-15658394 TGGGGATGACCCGGCCGTCTGGG - Exonic
1163216294 19:15879767-15879789 TGGGGATGACCCGGCCGTCTGGG + Exonic
1163245029 19:16088149-16088171 TGGGAAGGAGCTGGCTGTGTTGG + Intronic
1163437905 19:17306196-17306218 TGGGGAGGCCCCAGGCGTCTGGG - Exonic
1165353078 19:35287310-35287332 TGGGAAGGCCCAGGCTGGGCGGG + Intergenic
1165966424 19:39584641-39584663 TGGGCAGGCCCCTCCCTTGTGGG - Intergenic
1165972138 19:39640427-39640449 TGGGCAGGCCCCTCCCTTGTAGG - Intergenic
1166218881 19:41353098-41353120 TGGGGAGGCCCCGCCCCTGCAGG + Exonic
1166751281 19:45165059-45165081 TGGGCAGGCCCCGGGCGGGGAGG - Intronic
1166836568 19:45670998-45671020 TGGGAAGGGCCCTTCCGGGTGGG + Intronic
1168649643 19:58085209-58085231 TGGGAAGGCCCCGGACCCGCAGG - Exonic
925384577 2:3453267-3453289 TGGTCAGGCGCCGGCAGTGTGGG - Intronic
925715547 2:6781499-6781521 TGGGGAGAGCCCGGCCCTGTGGG + Intergenic
927693899 2:25227326-25227348 TGGAAAGACCCCGGCCCTTTGGG + Intergenic
934753494 2:96809540-96809562 TGGGGAGGCCCCCGCAGGGTGGG - Exonic
938248433 2:129796377-129796399 AGGGAGGGCCCCAGCTGTGTTGG + Intergenic
941178963 2:162235212-162235234 TGGGGAGGCTCAGGCCGTGCAGG - Intronic
946929191 2:224655600-224655622 TGGGGAGGCTCAGGCCGTGCAGG - Intergenic
947103840 2:226648310-226648332 TGGGGAGGCTCAGGCCGTGCAGG - Intergenic
1172359302 20:34301230-34301252 TGGGAGGGGCCCGGCTGTATGGG + Intronic
1176021978 20:62966709-62966731 TGCCAAGGCCCCGGCTGTGTTGG - Exonic
1179291332 21:40020725-40020747 TGGGAAGGAACCGGCAGTGCGGG - Intronic
1179899055 21:44379513-44379535 TGGGGAGGCCTCAGCCGAGTCGG + Intronic
1179953463 21:44724452-44724474 TGGGAAGGCTCTGGCTCTGTGGG + Intergenic
1180161938 21:46002079-46002101 TGGGAGGGTCCTGGCCGCGTGGG - Intronic
1182430491 22:30295963-30295985 TGGGAAGGCCCAGTCTGTGATGG - Intronic
1183913013 22:41092661-41092683 TGGGCAGGGGCCGGCCGTGGCGG + Exonic
950539100 3:13599459-13599481 TGGGCAGGACCCCACCGTGTAGG + Intronic
950601270 3:14037503-14037525 TGGGGAGGCTCGGGCCGTGTGGG - Intronic
950715963 3:14848053-14848075 TGGGGAGGACCTGGCAGTGTTGG - Intronic
954131400 3:48562949-48562971 TGGGCAGCCCACGGCCATGTGGG + Exonic
955387593 3:58491992-58492014 TGGGAAGGCGCCGCCCGCGCCGG + Intergenic
957054012 3:75430711-75430733 TGGGGAGGCCCCTGCCATGCTGG + Intergenic
959002845 3:100984808-100984830 TGGGAAGGCCCCGAAAGTGCAGG - Intronic
961300824 3:125921004-125921026 TGGGGAGGCCCCTGCCATGCTGG - Intergenic
961547990 3:127649289-127649311 TGGGCAGTCCCCTGCCATGTGGG + Intronic
961887682 3:130107088-130107110 TGGGGAGGCCCCTGCCATGCTGG + Intronic
969326430 4:6447100-6447122 TGGGAAGGACCAGGCCTTGGGGG + Intronic
969757192 4:9157658-9157680 TGGGGAGGCCCCTGCCATGCTGG - Intergenic
969791920 4:9498515-9498537 TGGGGAGTCCCAGGCCGCGTGGG + Intergenic
969817143 4:9695223-9695245 TGGGGAGGCCCCTGCCATGCTGG - Intergenic
972532971 4:39977320-39977342 CGGGAAGGCCTCGGCGGTGCCGG - Intronic
977885200 4:102245336-102245358 TGGGGAGGCCTGGGCTGTGTGGG - Intergenic
978254839 4:106681510-106681532 TGGGGAGGCTCAGGCCGTTTAGG + Intergenic
978754317 4:112286068-112286090 TGGGAAGGCGCGGTCCGGGTCGG - Intronic
979530513 4:121764974-121764996 CTGGAGCGCCCCGGCCGTGTTGG + Exonic
980025226 4:127758142-127758164 TGGGAAGGACCCGGGGGTGGTGG - Intronic
985280672 4:188283043-188283065 CGTGAAGGCCTCGTCCGTGTCGG - Intergenic
985566883 5:623378-623400 TGGAAAGGCCCCGGTGGTGGAGG + Intronic
995523358 5:113031419-113031441 TGGGAAGGCCGAGGAGGTGTTGG - Intronic
996575853 5:124976180-124976202 TGGGGAGGCTCGGGCCATGTGGG + Intergenic
997158154 5:131580098-131580120 TGGGGAGGCTCGGGCCGCGTGGG + Intronic
998256702 5:140594034-140594056 TGGGAAGGGGCCGGGCGTGGTGG - Intergenic
1007821598 6:44564476-44564498 GGGAAAGGCCCCGGCCCTGAAGG + Intergenic
1012568721 6:100695468-100695490 TCAGAAGGCCCTGGACGTGTAGG - Intronic
1013366241 6:109440567-109440589 TGGCAAGGCCGCAGCCGTGCGGG - Exonic
1014095113 6:117451707-117451729 TGGGAAGTCCCTGGCCTCGTGGG - Intronic
1014976565 6:127892134-127892156 TGGGCAGGCCCAGACCTTGTAGG - Intronic
1018868168 6:167761221-167761243 TGGGAAGACCCTGGCCCTGAAGG + Intergenic
1019274146 7:167094-167116 TGGGAAGGGCTGGGCCTTGTGGG - Intergenic
1033306924 7:140231620-140231642 TGGTAAGGCCCCTGCCGTGGAGG + Intergenic
1036380424 8:8232973-8232995 TGGGGAGGCCCCTGCCATGCCGG - Intergenic
1036668668 8:10765376-10765398 TCGGAAGGCCCCGGCTGGGAAGG + Exonic
1043731910 8:83694059-83694081 TGGGGAGGCTCAGGCCGCGTGGG + Intergenic
1054800919 9:69347385-69347407 GGGGAAGGCCACAGCCATGTTGG - Intronic
1057168239 9:92945025-92945047 TGGGAAGTCACCTGCCATGTGGG + Intergenic
1057468444 9:95337290-95337312 TGGGAAGGCCCTGTCCTTGCAGG + Intergenic
1061516808 9:131094910-131094932 TGGGGTGGCCCCTGCCCTGTAGG + Intergenic
1062484475 9:136768226-136768248 TGGGAAGCCCCCTGCCCTGTGGG - Intergenic
1189284539 X:39841817-39841839 TGGGAAGGCCCAGCCAGTGGCGG - Intergenic
1190292243 X:49000768-49000790 TGGGAAGGAACCGGCCTTGCTGG - Intronic
1196388972 X:115189978-115190000 CGGGAAGGCACCGACTGTGTCGG + Exonic
1196389006 X:115190107-115190129 TGGGAAGGCCCCGGCCGTGTGGG + Exonic
1198722157 X:139634755-139634777 TTGGAAGGGCAGGGCCGTGTAGG - Intronic
1199897454 X:152138050-152138072 AGGGAAGGCCCGGGCCCTGCTGG - Intronic