ID: 1196397546

View in Genome Browser
Species Human (GRCh38)
Location X:115281188-115281210
Sequence CTAACTAATTACAGTTATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196397540_1196397546 4 Left 1196397540 X:115281161-115281183 CCCACCCTAATCTACTATGACCT No data
Right 1196397546 X:115281188-115281210 CTAACTAATTACAGTTATGAAGG No data
1196397541_1196397546 3 Left 1196397541 X:115281162-115281184 CCACCCTAATCTACTATGACCTC No data
Right 1196397546 X:115281188-115281210 CTAACTAATTACAGTTATGAAGG No data
1196397542_1196397546 0 Left 1196397542 X:115281165-115281187 CCCTAATCTACTATGACCTCATC No data
Right 1196397546 X:115281188-115281210 CTAACTAATTACAGTTATGAAGG No data
1196397543_1196397546 -1 Left 1196397543 X:115281166-115281188 CCTAATCTACTATGACCTCATCC No data
Right 1196397546 X:115281188-115281210 CTAACTAATTACAGTTATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196397546 Original CRISPR CTAACTAATTACAGTTATGA AGG Intergenic
No off target data available for this crispr