ID: 1196399686

View in Genome Browser
Species Human (GRCh38)
Location X:115300753-115300775
Sequence GGTGGTGCCAAGAGCATCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 1, 2: 7, 3: 40, 4: 247}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196399686_1196399693 2 Left 1196399686 X:115300753-115300775 CCAGAGATGCTCTTGGCACCACC 0: 1
1: 1
2: 7
3: 40
4: 247
Right 1196399693 X:115300778-115300800 GTCATTGCTGCCGGGAGTTGGGG 0: 1
1: 0
2: 1
3: 8
4: 141
1196399686_1196399696 8 Left 1196399686 X:115300753-115300775 CCAGAGATGCTCTTGGCACCACC 0: 1
1: 1
2: 7
3: 40
4: 247
Right 1196399696 X:115300784-115300806 GCTGCCGGGAGTTGGGGGAAGGG 0: 1
1: 3
2: 34
3: 272
4: 1140
1196399686_1196399687 -7 Left 1196399686 X:115300753-115300775 CCAGAGATGCTCTTGGCACCACC 0: 1
1: 1
2: 7
3: 40
4: 247
Right 1196399687 X:115300769-115300791 CACCACCATGTCATTGCTGCCGG 0: 1
1: 0
2: 2
3: 14
4: 164
1196399686_1196399692 1 Left 1196399686 X:115300753-115300775 CCAGAGATGCTCTTGGCACCACC 0: 1
1: 1
2: 7
3: 40
4: 247
Right 1196399692 X:115300777-115300799 TGTCATTGCTGCCGGGAGTTGGG 0: 1
1: 0
2: 0
3: 5
4: 108
1196399686_1196399698 17 Left 1196399686 X:115300753-115300775 CCAGAGATGCTCTTGGCACCACC 0: 1
1: 1
2: 7
3: 40
4: 247
Right 1196399698 X:115300793-115300815 AGTTGGGGGAAGGGTGACATTGG 0: 1
1: 1
2: 15
3: 75
4: 469
1196399686_1196399691 0 Left 1196399686 X:115300753-115300775 CCAGAGATGCTCTTGGCACCACC 0: 1
1: 1
2: 7
3: 40
4: 247
Right 1196399691 X:115300776-115300798 ATGTCATTGCTGCCGGGAGTTGG 0: 1
1: 0
2: 0
3: 10
4: 100
1196399686_1196399688 -6 Left 1196399686 X:115300753-115300775 CCAGAGATGCTCTTGGCACCACC 0: 1
1: 1
2: 7
3: 40
4: 247
Right 1196399688 X:115300770-115300792 ACCACCATGTCATTGCTGCCGGG 0: 1
1: 0
2: 2
3: 15
4: 165
1196399686_1196399694 3 Left 1196399686 X:115300753-115300775 CCAGAGATGCTCTTGGCACCACC 0: 1
1: 1
2: 7
3: 40
4: 247
Right 1196399694 X:115300779-115300801 TCATTGCTGCCGGGAGTTGGGGG 0: 1
1: 0
2: 0
3: 14
4: 184
1196399686_1196399695 7 Left 1196399686 X:115300753-115300775 CCAGAGATGCTCTTGGCACCACC 0: 1
1: 1
2: 7
3: 40
4: 247
Right 1196399695 X:115300783-115300805 TGCTGCCGGGAGTTGGGGGAAGG 0: 1
1: 6
2: 57
3: 318
4: 1142
1196399686_1196399699 26 Left 1196399686 X:115300753-115300775 CCAGAGATGCTCTTGGCACCACC 0: 1
1: 1
2: 7
3: 40
4: 247
Right 1196399699 X:115300802-115300824 AAGGGTGACATTGGCGATTCAGG 0: 1
1: 0
2: 3
3: 22
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196399686 Original CRISPR GGTGGTGCCAAGAGCATCTC TGG (reversed) Intronic
900554223 1:3271743-3271765 GGTGATGCCAGGATCATCTCTGG - Intronic
900976559 1:6020412-6020434 GGTGGTGCTGGGGGCATCTCAGG - Intronic
900989064 1:6089646-6089668 GCTGGTGCTTAGAGCAGCTCAGG - Intronic
901166035 1:7222292-7222314 GCTGGTTCCATGAGCACCTCTGG + Intronic
904697633 1:32339186-32339208 GGTGGGGCCGGGAGCATCTCAGG - Intergenic
906216595 1:44044558-44044580 AGGGGTGCCAACAGCATCTAGGG + Intergenic
906903227 1:49860965-49860987 AGTGGTGCAAAGAGCATCTCTGG + Intronic
909130452 1:71729181-71729203 GGTGGTGTGAGGAGCATGTCAGG - Intronic
911395000 1:97294638-97294660 TGTGATGCCAAGAGCAACTTTGG - Intronic
911496392 1:98637113-98637135 TGTGGTGCGGTGAGCATCTCTGG + Intergenic
912036769 1:105325751-105325773 GGTGGTGCAAAGAACATCTTTGG - Intergenic
912048325 1:105489828-105489850 GTTGGTGCCAAGATCAACTGTGG - Intergenic
913706780 1:121433681-121433703 CGTGTTGTCGAGAGCATCTCTGG + Intergenic
915806712 1:158861380-158861402 AGTGGTGCCAAGAGGATTTTAGG + Intergenic
916910184 1:169337586-169337608 GGAGGTGCCAAGAGCGACTGAGG + Intronic
917003493 1:170386273-170386295 TGTGGTGCCGAGAGCACCTCTGG - Intergenic
917445481 1:175102809-175102831 GGAGGTGCCAAGAGCAAGTGAGG + Intronic
917446437 1:175108966-175108988 GGAGGTGCCAAGAGCAAGTGAGG + Intronic
918261272 1:182798645-182798667 GGTGATGCCAAGAACATTTGAGG - Intronic
918406885 1:184220313-184220335 GGTGGTTCTCAGAGCAGCTCTGG - Intergenic
918756673 1:188346181-188346203 CATGGTGCGGAGAGCATCTCTGG - Intergenic
920216893 1:204367353-204367375 GGTGGTGGCAAGGCCAGCTCCGG - Intronic
921300778 1:213749622-213749644 CAGGGTGCCAAGAGCACCTCGGG + Intergenic
922046039 1:221946926-221946948 TGTGGTGCGGAGAGCCTCTCAGG - Intergenic
923324888 1:232871952-232871974 GGAGGTGCCAAGAGCAAGTGAGG + Intergenic
923465646 1:234246007-234246029 GAGGGTGGCAAGATCATCTCGGG + Intronic
923879126 1:238084306-238084328 GGGGTTGCTGAGAGCATCTCTGG - Intergenic
924543311 1:245001552-245001574 GGTGGTGTCAAGAGCAAGGCAGG + Intronic
924648650 1:245903643-245903665 CGTGGTGACAAGAGCATCTCTGG + Intronic
1062883371 10:996923-996945 GGTGGGGCCAACAGCATGTCTGG - Intronic
1063978290 10:11434207-11434229 GATGGTGCCAAGAGCACTTAAGG + Intergenic
1064696925 10:17976003-17976025 TGTGGTGCAGAGAGCATCTCTGG - Intronic
1065428650 10:25631490-25631512 GGAGGTGCTAAGAGCACCCCCGG - Intergenic
1065461146 10:25965879-25965901 GGTGGTGCCCAGAGTTTCTCTGG - Intronic
1068529203 10:58165699-58165721 GGTGGAACCAAGAGCAGCTGTGG + Intergenic
1069730476 10:70608559-70608581 GGTGGTGCCAAGCGAAGCTGTGG + Intergenic
1072267990 10:93748836-93748858 GGGGGTGCTAAGAGCATTTGGGG + Intergenic
1073026524 10:100490813-100490835 GAAGGTGCCAAGGGCATCGCTGG + Exonic
1073453963 10:103625507-103625529 GGTGGGGGCAAGGGCATTTCAGG + Intronic
1075800251 10:125149329-125149351 GGTGGGGCCAGGATCATCCCTGG - Intronic
1076001560 10:126917129-126917151 GGTGTTGCCCAGAGCTGCTCGGG - Intronic
1076696879 10:132251327-132251349 GGTGGTGCCATGGGCAGCCCTGG + Intronic
1076881727 10:133242661-133242683 GGTGGGGCCAAGAGCACCTGGGG - Intergenic
1079272404 11:19000499-19000521 TGTGGTGCTGACAGCATCTCTGG - Intergenic
1079729414 11:23921381-23921403 GCTGGTGCAGAGAGCACCTCTGG - Intergenic
1084114421 11:67033487-67033509 AGAGGTGCGAAGAGCACCTCAGG - Intronic
1084593680 11:70104913-70104935 GGTGGAGCCATGAGCATCACTGG + Intronic
1086927839 11:92659810-92659832 TGGGTTGCCAAGAGCATCTCAGG + Intronic
1088435110 11:109803997-109804019 GGTGGTGGCAAGAGAAACTGAGG + Intergenic
1090731304 11:129575307-129575329 GGTAGGGCCAAGATCATCACAGG - Intergenic
1091790005 12:3266684-3266706 GTTGGTGCTGAGACCATCTCTGG + Intronic
1092288041 12:7141207-7141229 GGTAGGGGCAAGAGCCTCTCAGG - Intronic
1096532024 12:52248405-52248427 GGTGGGGCCAGGAGCACCTGGGG + Intronic
1097563738 12:61240488-61240510 TGTGTTGCCCAGAGCATCTCTGG - Intergenic
1097791214 12:63817626-63817648 CATGGTGCAAAGAGCATCTATGG + Intergenic
1100788697 12:98106854-98106876 GATAGTGACAAGAGCATCTATGG - Intergenic
1103800023 12:123532237-123532259 GGGGCTGCCAAGAGCATCCCTGG + Intronic
1105243179 13:18625635-18625657 TGAGGTGCATAGAGCATCTCGGG - Intergenic
1106964202 13:35039198-35039220 CTTGGTGCCAAGAGCATCTCTGG - Intronic
1108787471 13:53921746-53921768 GGTGGTGCCAAGAGCAGCTGTGG - Intergenic
1108989746 13:56640186-56640208 CCTGGTGCAGAGAGCATCTCTGG + Intergenic
1109016364 13:57020510-57020532 CATGGTGCCATGAGCATCTCTGG + Intergenic
1109304181 13:60620482-60620504 GGTGGGGCAAAGGGCATTTCAGG - Intergenic
1111612606 13:90623203-90623225 GGGGGTGGCAATAGCATCTATGG + Intergenic
1113766971 13:112887848-112887870 GGTGGATCCTAGAGCATCCCTGG + Intergenic
1114072794 14:19127846-19127868 CTTGGTGCCAAGAGCATCTCTGG - Intergenic
1114089467 14:19272126-19272148 CTTGGTGCCAAGAGCACCTCTGG + Intergenic
1114568176 14:23647539-23647561 GGTGATGCCCAGGGGATCTCAGG - Intergenic
1114960472 14:27881821-27881843 CGTGGTTCAAAGAGCATCCCTGG - Intergenic
1114988081 14:28253826-28253848 TGTGATGCAGAGAGCATCTCTGG - Intergenic
1116406956 14:44578519-44578541 CATGGTGCAGAGAGCATCTCTGG + Intergenic
1118599507 14:67461994-67462016 GCTGGTGCCCAGAGCCTCCCTGG - Intronic
1119430271 14:74563055-74563077 GGTGGTGGGAGGAGCTTCTCAGG - Intronic
1119486696 14:74994006-74994028 GGAGGTGCCAAGAGCAAGTGAGG - Intergenic
1119740157 14:77008872-77008894 GTTGGTGTGAAGAGGATCTCGGG + Intergenic
1121039287 14:90731704-90731726 GATGGTGCCGCGTGCATCTCTGG - Intronic
1121316201 14:92962364-92962386 GTTGGTGCCATGAGCCACTCTGG + Exonic
1122834557 14:104424441-104424463 AGTGCTTCCAGGAGCATCTCAGG + Intergenic
1129377982 15:75145957-75145979 GGTGGTGGCAGGAGCAGCTGTGG - Intergenic
1130907033 15:88247982-88248004 TGGGGTGCCAGGAGCATTTCTGG - Intronic
1132987244 16:2773899-2773921 GGGAGTGCCAAGAGCATATCTGG - Intronic
1133325775 16:4941294-4941316 TGTGTTGCCAAAAGCATCCCAGG - Intronic
1133929802 16:10222949-10222971 TGCGGTACCCAGAGCATCTCTGG + Intergenic
1134568745 16:15273773-15273795 GGTGGTTCAAAGAGCATCAGTGG - Intergenic
1134733689 16:16482589-16482611 GGTGGTTCAAAGAGCATCAGTGG + Intergenic
1134933812 16:18229693-18229715 GGTGGTTCAAAGAGCATCAGTGG - Intergenic
1135879426 16:26239977-26239999 CGTGGTGCAGAGAGCATCTCTGG + Intergenic
1137581224 16:49634681-49634703 GGAGGTGCCAGGCGGATCTCAGG - Intronic
1138966167 16:62086561-62086583 GGTGGATCAAAGAGCATTTCTGG - Intergenic
1139446497 16:67001435-67001457 GCGGGGGCCATGAGCATCTCAGG + Exonic
1139507082 16:67404185-67404207 GGAGGAGCCAAGAGCATGTGGGG + Intronic
1139744035 16:69059984-69060006 GGGGCTGCCATGAGCTTCTCAGG - Intronic
1141994114 16:87626119-87626141 GGGGGTGCCAAGAGCAACAGCGG + Intronic
1142218836 16:88842898-88842920 CATGGTGCCAAGAGCGTGTCGGG + Intronic
1146551483 17:33783938-33783960 GTTCCTGCCAAGGGCATCTCTGG - Intronic
1146775748 17:35614133-35614155 GGGGCTGTCAAGAGCATCTCTGG - Intronic
1147449256 17:40493719-40493741 TGTGGTGCCCAGGGCATCTGTGG + Intronic
1148808944 17:50278447-50278469 GCTTGTGCCATGAGCATCTTGGG + Intronic
1153075514 18:1157500-1157522 CTTGGTACCGAGAGCATCTCTGG + Intergenic
1153508161 18:5824586-5824608 GGAAGCGCCAAGAGCATATCAGG + Intergenic
1154386461 18:13897176-13897198 CGTGGTGTGGAGAGCATCTCTGG + Intronic
1154445754 18:14434261-14434283 TGAGGTGCATAGAGCATCTCGGG + Intergenic
1156516695 18:37686173-37686195 GGGGGTGCCAAGGGCACTTCTGG + Intergenic
1157212153 18:45752823-45752845 GGTGGTGCCCAGGGCCTGTCTGG - Intergenic
1157326799 18:46674915-46674937 GGAGGTGGCAGGAGGATCTCTGG + Intronic
1158705833 18:59790959-59790981 GGAGGTGCCAAGAGCAAGCCAGG + Intergenic
1160573409 18:79833940-79833962 TGTGCTGCCCAGAGCATCTGTGG - Intergenic
1161082378 19:2317706-2317728 GGTGGTACCCTGAGGATCTCTGG + Intronic
1161971375 19:7582746-7582768 GGTGTTGCCAAGACAATTTCAGG - Intergenic
1162330677 19:10027421-10027443 GGAGGTGTCAGGAGCTTCTCAGG - Intergenic
1163030108 19:14538481-14538503 TCAGGTGCCAAAAGCATCTCAGG - Intronic
1165006970 19:32815191-32815213 GGGGGTGGCAAGAGCAAATCTGG - Intronic
1165933018 19:39372563-39372585 GGTGCTGCCAAGAACAGATCAGG + Intronic
926297139 2:11577240-11577262 GATGGTGCCACCAGCATCTGGGG + Intronic
926991799 2:18688212-18688234 TGTGGTGCAGAGAGCATCTCTGG - Intergenic
929926664 2:46217902-46217924 CATGGTGCAGAGAGCATCTCTGG - Intergenic
930492620 2:52094027-52094049 CATGGTGCTGAGAGCATCTCTGG - Intergenic
931298872 2:60957443-60957465 TGTGGTGCCCAGAGCAACACTGG + Intronic
935146620 2:100399789-100399811 GGTGGTGGGAAGAGCATCCTGGG + Intronic
935532573 2:104253253-104253275 TGTGTTGCAGAGAGCATCTCTGG + Intergenic
935928350 2:108094366-108094388 CATGGTGCAGAGAGCATCTCTGG - Intergenic
936234910 2:110733859-110733881 GGGGGACCCAAGAGCATTTCAGG + Intronic
937433739 2:121862787-121862809 CATGATGCCAAGAGCCTCTCAGG + Intergenic
942675870 2:178426506-178426528 GTTTGTGCCAAGAGGATCTGTGG + Intergenic
945972949 2:216247850-216247872 GGTGATGCCACTAGCAACTCAGG - Intergenic
946663788 2:222028641-222028663 GGTGGTGCCCATAGCAGCTGAGG - Intergenic
947388562 2:229616764-229616786 GGTGATGCCAGGACCATCTCTGG + Intronic
947442752 2:230137322-230137344 GGTGGTGCCAAGACGGTTTCAGG + Intergenic
948879942 2:240851503-240851525 GGTGGAGCCAGGACCAGCTCAGG - Intergenic
1168919208 20:1516891-1516913 GGTGGGGCCAAGTGCCTCACAGG + Intergenic
1169586867 20:7095581-7095603 TGTGGTACAGAGAGCATCTCTGG + Intergenic
1172303572 20:33865983-33866005 GCTGGTGCCTAGACCCTCTCTGG + Intergenic
1174056648 20:47802834-47802856 GCTGGTGCCTAGAGCATGCCTGG - Intergenic
1174084695 20:47998649-47998671 GCTGGTGGGAAGAGCAGCTCAGG + Intergenic
1174107129 20:48170753-48170775 GGTAGGGTCAAGAGCATGTCTGG + Intergenic
1175173011 20:57093023-57093045 GGGGCTGCCAAGAGCAGCACAGG + Intergenic
1176150600 20:63588927-63588949 GGTGGAGCCCAGAGCCTGTCTGG - Exonic
1178216490 21:30605125-30605147 CCTGGTGCAGAGAGCATCTCTGG + Intergenic
1178467302 21:32859603-32859625 GGTGGTGACAGGAGCAGCTGTGG - Intergenic
1180491238 22:15850221-15850243 CTTGGTGCCAAGAGCACCTCTGG - Intergenic
1180972944 22:19825035-19825057 GGTGGTGCCAGTGGCCTCTCTGG - Intronic
1181033656 22:20159774-20159796 GGAGGTGCCAGGAGCCTCCCGGG + Intergenic
1181509653 22:23383471-23383493 GGAGGTGCCAGGAGCCTCCCGGG - Intergenic
1184112168 22:42401813-42401835 GGTGCTGCCATCAGCAGCTCAGG + Intronic
950878774 3:16304409-16304431 GCTGGTGCCAAGAACAATTCTGG - Exonic
953481763 3:43258098-43258120 GGTGGTGCCTAGCTCAGCTCTGG + Intergenic
959413905 3:106061117-106061139 CGTGGTGCAAAGAGCATCTCTGG + Intergenic
959456567 3:106570515-106570537 GGAGGTCCCAAGACCACCTCTGG + Intergenic
959776993 3:110177791-110177813 GGTAGTGCCAAAATTATCTCAGG + Intergenic
960541462 3:118866351-118866373 GGTGGTGCCCAGGGTAGCTCTGG - Intergenic
960706504 3:120487298-120487320 CCTGTTGCCAAGAACATCTCAGG + Intergenic
961018645 3:123486015-123486037 AGTGGTCCCCAGAGCATATCTGG - Intergenic
962106415 3:132395296-132395318 AGTGGTGCAGAGAGCATCTCTGG + Intergenic
962151812 3:132901888-132901910 GATGGTGCGAAGAGCATCTCTGG + Intergenic
964936571 3:162095604-162095626 CATGGTGCAAAAAGCATCTCTGG - Intergenic
964992880 3:162835847-162835869 TGTGGTGCTGAGATCATCTCTGG - Intergenic
965350786 3:167609361-167609383 CGTGGTGCTGAGAGCTTCTCTGG + Intronic
966121743 3:176529357-176529379 TGTGGTGCAGAGAGCATCTCTGG + Intergenic
966142446 3:176771229-176771251 CATGGTGCAGAGAGCATCTCTGG - Intergenic
966514702 3:180805984-180806006 GGTGCAGCCATGAGAATCTCAGG - Intronic
967198571 3:187050882-187050904 GGTGATACCAAGAGAATATCTGG + Intronic
967844102 3:194030934-194030956 GGTGGGGTCAAGAGAAACTCTGG - Intergenic
969228231 4:5812728-5812750 GGAGCTGCCCAGAGCATCACAGG + Exonic
969876509 4:10139539-10139561 GGGGGTCCCAGGAGCATCTTGGG + Intergenic
970958795 4:21848200-21848222 GGTGGTGCCATGGGCTTTTCAGG - Intronic
971073286 4:23119569-23119591 GGTGGGGGGAAGAGCATCTCAGG + Intergenic
971384703 4:26132427-26132449 GCAGGTGCCATGAGCAGCTCTGG - Intergenic
971384708 4:26132455-26132477 GCAGGTGCCATGAGCAGCTCTGG - Intergenic
971558833 4:28047931-28047953 CATGGTGCAGAGAGCATCTCTGG - Intergenic
972100221 4:35406664-35406686 GGTGGTGCCAAGAGAAAATGAGG - Intergenic
972272332 4:37523315-37523337 CGTGGTGCAGAGAGCATCTCTGG - Intronic
972337666 4:38122111-38122133 GGTGGTGAGTGGAGCATCTCTGG + Intronic
972900048 4:43672210-43672232 GGAGGTGCCAAGAGCAAGTGAGG - Intergenic
975095446 4:70451281-70451303 TGTGGTGTGGAGAGCATCTCTGG - Intronic
975252591 4:72197463-72197485 GTTGGTGTGTAGAGCATCTCTGG + Intergenic
976012858 4:80512698-80512720 TGTGGTGCAAAAAGCATCTTTGG + Intronic
977044299 4:92050405-92050427 TTTGGTGCAGAGAGCATCTCTGG + Intergenic
977399056 4:96509223-96509245 CATGGTGCAGAGAGCATCTCTGG + Intergenic
982615205 4:157632945-157632967 TGTGGTGCAGAGAGCTTCTCTGG + Intergenic
983397515 4:167219178-167219200 GATGTTGCCAAGGGCACCTCAGG + Intronic
983456171 4:167968088-167968110 TGTGGTGCAAAAGGCATCTCTGG + Intergenic
983490846 4:168387263-168387285 GGTGGTGCCAAGATAAACTGTGG + Intronic
984632879 4:182078916-182078938 GCTGGTGCCAAGAGTAGGTCTGG - Intergenic
987117889 5:14740558-14740580 GGTGGTGACAAGGGCAGCTGAGG + Intronic
987822986 5:22990622-22990644 TGTGGTGCAGGGAGCATCTCTGG + Intergenic
989628853 5:43460632-43460654 AGTGGGGCAGAGAGCATCTCTGG + Intronic
989970881 5:50522215-50522237 TGTGTTGTCGAGAGCATCTCTGG - Intergenic
990367171 5:55082870-55082892 GGTGGTCCCCAGAACATCTGTGG - Intergenic
990437587 5:55808942-55808964 GGTGGAGCCCACCGCATCTCAGG - Intronic
991018807 5:61958938-61958960 GGTGGTTCAGAGAACATCTCTGG - Intergenic
992687043 5:79209246-79209268 GGATATGCCAAGAGCATCACAGG + Intronic
992693345 5:79260346-79260368 GGTGGTGGCAAGAGCAGCTGTGG - Intronic
993108441 5:83626536-83626558 GGTGGGGCCAAGAAAATCTGAGG - Intergenic
993580253 5:89652513-89652535 TGTGCTGCGGAGAGCATCTCTGG + Intergenic
994477776 5:100291748-100291770 CATGCTGCCAAGAGTATCTCTGG - Intergenic
994614681 5:102089522-102089544 CATGGTGCAGAGAGCATCTCTGG - Intergenic
996700310 5:126444188-126444210 GGTGGTGGCAAGAGAATTTATGG + Intronic
996927505 5:128845814-128845836 TATGGTGCAGAGAGCATCTCTGG + Intronic
998612363 5:143703278-143703300 GTTGGGGCCAAGAGGATCACAGG + Intergenic
998695111 5:144630139-144630161 TGTGGTACAAAGAGCATCTCTGG + Intergenic
999406718 5:151313089-151313111 CATGGTGCCCAGAGTATCTCTGG - Intergenic
999734641 5:154503732-154503754 TGTGCTGCCAAGAGGATCTAAGG + Intergenic
1000454810 5:161436799-161436821 AGTAGTGCTGAGAGCATCTCTGG + Intronic
1004941680 6:20564916-20564938 GGTCCTGCGAAGAGCTTCTCTGG + Intronic
1005274397 6:24200456-24200478 GGTGGTGACAAAAGTCTCTCAGG - Intronic
1005464977 6:26104071-26104093 GGTGGCGTCAAGCGCATTTCCGG + Exonic
1005475619 6:26204768-26204790 GGGGGTGTCAAGCGCATTTCTGG + Exonic
1005480012 6:26246832-26246854 GGCGGTGTCAAGCGCATCTTGGG - Exonic
1008053237 6:46921332-46921354 GCTCTTGCCAAGAGCATTTCAGG - Intronic
1008979211 6:57463999-57464021 GGAGGTGCAAAGAGCATTCCTGG - Intronic
1009167346 6:60356991-60357013 GGAGGTGCAAAGAGCATTCCTGG - Intergenic
1009471347 6:64031012-64031034 GGAGGTGCCAAGAGCAAGTGAGG - Intronic
1011260218 6:85462363-85462385 GATGCTGCTAAGAGCATCGCTGG - Intronic
1011901239 6:92301351-92301373 TGTGGTACAAAGAACATCTCTGG + Intergenic
1012827540 6:104164743-104164765 TGTGGTGCCAAGAGCATCTCTGG + Intergenic
1014844033 6:126253952-126253974 GGTGGTGGCAAGTTAATCTCTGG - Intergenic
1015735796 6:136398645-136398667 GGTGGTGGCAAGAGCAAATGAGG - Intronic
1017528027 6:155259802-155259824 GCTGCTGCCAAGAGGCTCTCAGG - Intronic
1017540277 6:155394778-155394800 GGGGGTGCAAACAGCATCCCCGG + Intergenic
1019620078 7:1987614-1987636 GTTGGTGCCGAGAGCACCCCGGG - Intronic
1019849765 7:3542971-3542993 CCTGGTGCCAAGAGCCTCTTTGG + Intronic
1021777481 7:24067793-24067815 GGTGGTGCCAAGGGTGACTCAGG + Intergenic
1025236356 7:57237344-57237366 GCTGGTGCCTAGAGCATGCCTGG + Intergenic
1028338940 7:89694342-89694364 CTTGGTGCGGAGAGCATCTCTGG + Intergenic
1029170772 7:98627753-98627775 GTTGGTACCATGAGCATCCCAGG - Intronic
1029724848 7:102396060-102396082 GGAGGTGCCGAGAGCATCAGCGG + Exonic
1032191846 7:129770162-129770184 GGTGCTGCCAAGAGGAGCTGGGG - Intergenic
1032314572 7:130823360-130823382 GATGGTGTCAAGAGCATTTCTGG - Intergenic
1032971899 7:137174534-137174556 GGTGGTGCCCGGAGTGTCTCTGG + Intergenic
1034367757 7:150566687-150566709 AGTGGTTCCAGGACCATCTCAGG + Intergenic
1036656318 8:10679619-10679641 GGAGGGGCCAAGATCAGCTCTGG - Intronic
1036826467 8:11980122-11980144 GGCGGTGTCAGGATCATCTCAGG + Intergenic
1036949515 8:13127874-13127896 GGAGGTGCCAAAGGCATCTGAGG + Intronic
1037241471 8:16783761-16783783 GGAGGTGCCAAGAGCAAGTGAGG - Intergenic
1038872002 8:31504764-31504786 CATGGTGCAGAGAGCATCTCTGG - Intergenic
1039282264 8:35998350-35998372 TCTGGTGCAGAGAGCATCTCTGG - Intergenic
1041869368 8:62615803-62615825 TGTGGTGCTAAGAGCAGCTCTGG - Intronic
1043110044 8:76169462-76169484 GGAGGTGCCAAGAGCAAGTGAGG - Intergenic
1043366738 8:79542193-79542215 CCTGGTGCAGAGAGCATCTCTGG + Intergenic
1043724411 8:83591184-83591206 CGTGGTGCAGAGAGCTTCTCTGG - Intergenic
1044456067 8:92394057-92394079 GGAGGTGCCAAGAGCAAGTGAGG + Intergenic
1045993135 8:108333642-108333664 TGTGGTGCCAAGAGCAAATCTGG + Intronic
1046019873 8:108651705-108651727 GGTGGTGCCTAGAGAATATGTGG + Intronic
1047955813 8:129974443-129974465 AGTGCTGCCTAGAGCATCCCAGG - Intronic
1049179040 8:141211390-141211412 GGTGGTGCCCAGCCCATCCCTGG + Exonic
1049454628 8:142680711-142680733 GGTCGTGCCAAGAGCTTCCCTGG - Intronic
1051991275 9:23154963-23154985 TGTGGTGCAAAAAGCATGTCTGG - Intergenic
1052576184 9:30294176-30294198 GGTGGTGGCAAGAGAAACTGAGG + Intergenic
1052609916 9:30758966-30758988 AGGGGTGCCAAGGGCAGCTCGGG - Intergenic
1052815927 9:33102583-33102605 GCTGGAGCCAAGAGCACCTTTGG - Intergenic
1053581779 9:39412412-39412434 GGTGTTGCTAAGAGCAACTGTGG + Intergenic
1054103359 9:60971144-60971166 GGTGTTGCTAAGAGCAACTGTGG + Intergenic
1054582996 9:66935693-66935715 GGTGTTGCTAAGAGCAACTGTGG - Intergenic
1056711301 9:88994083-88994105 GGTAGTGACAAGAGATTCTCTGG - Exonic
1056878891 9:90369285-90369307 GGTTCTGCCAAGAGCATGACAGG + Intergenic
1057211463 9:93203106-93203128 GGTGGGGCCCAGAGCTTTTCGGG + Intronic
1058780045 9:108324515-108324537 CATGGTGCAGAGAGCATCTCTGG + Intergenic
1059991641 9:119870790-119870812 GGAGGTGCCAAGAGCAAGTGAGG + Intergenic
1061626054 9:131841399-131841421 GGTGCTGCCCAGATCATCTTTGG + Intergenic
1061859315 9:133460058-133460080 GGTGGCACCATGAGCAGCTCAGG + Exonic
1062495748 9:136830801-136830823 GGTGCTGCCAACAGGGTCTCCGG - Intronic
1185839881 X:3379120-3379142 GGTGGGGGCTACAGCATCTCAGG + Intergenic
1191083285 X:56537195-56537217 CCTGGTGCGGAGAGCATCTCTGG + Intergenic
1192863622 X:75107029-75107051 TGTGGTGTGGAGAGCATCTCTGG + Intronic
1193192873 X:78593296-78593318 TGTGGTGCAGAGAGCTTCTCTGG - Intergenic
1193524608 X:82573593-82573615 CATGGTGCCGAGAACATCTCTGG - Intergenic
1193596532 X:83452282-83452304 CATGATGCCAAGAGCATCTCTGG - Intergenic
1193880264 X:86912167-86912189 AGTGGTGCACAGAGCATCTCTGG - Intergenic
1194348175 X:92792833-92792855 GGTGGTAAGAAGAGCATCTCTGG + Intergenic
1194495672 X:94614093-94614115 TGTGGTGTGGAGAGCATCTCTGG - Intergenic
1194887304 X:99332503-99332525 TGTGGTGTCTAGAGCATCTTTGG + Intergenic
1194889712 X:99363876-99363898 GCTGGTGCAGAGAGCCTCTCTGG + Intergenic
1194922086 X:99779165-99779187 TGTGGTACAGAGAGCATCTCCGG - Intergenic
1195014785 X:100767177-100767199 TGTGGTGCAGAGAGCATCTCTGG - Intergenic
1195155027 X:102114312-102114334 CATGGTGCAGAGAGCATCTCTGG - Intergenic
1196399686 X:115300753-115300775 GGTGGTGCCAAGAGCATCTCTGG - Intronic
1196591134 X:117486061-117486083 CATGGTGCAGAGAGCATCTCTGG - Intergenic
1196660406 X:118263559-118263581 TGTGGTGCAGAGAGGATCTCTGG + Intergenic
1196922001 X:120594372-120594394 CGTGGTGGGGAGAGCATCTCTGG + Intronic
1197010155 X:121551164-121551186 CAGGGTGCCAAGAGCATCTCTGG + Intergenic
1197449599 X:126594996-126595018 CATGGTGCCAAGAGCATTTCTGG - Intergenic
1197677501 X:129346428-129346450 TGTGGTGTACAGAGCATCTCTGG + Intergenic
1197810965 X:130442520-130442542 CGTGGTGCTGAGAGCATCTCTGG - Intergenic
1197830092 X:130632375-130632397 GGTGGTCCTAAGAGAAACTCAGG + Intronic
1198508830 X:137328666-137328688 GTTAGTCCCAAGAGCATTTCTGG + Intergenic
1198694755 X:139324257-139324279 CATGGTGCCAACAGCATCTCTGG + Intergenic
1198854886 X:141005400-141005422 TATGGTGTAAAGAGCATCTCTGG + Intergenic
1198877126 X:141239743-141239765 TATGGTGTAAAGAGCATCTCTGG - Intergenic
1198907807 X:141581969-141581991 TATGGTGTAAAGAGCATCTCTGG - Intergenic
1198908984 X:141592455-141592477 TATGGTGTAAAGAGCATCTCTGG + Intronic
1198918094 X:141695697-141695719 TGTGGTGTAAAGAGCATCTCTGG - Intronic
1199050480 X:143231587-143231609 CATGGTGCAGAGAGCATCTCTGG + Intergenic
1199076339 X:143530567-143530589 TATGGTGTAAAGAGCATCTCCGG - Intergenic
1199156015 X:144550316-144550338 CTTGGTGCAGAGAGCATCTCTGG + Intergenic
1200656504 Y:5909462-5909484 GGTGGTAAGAAGAGCATCTCTGG + Intergenic
1201303554 Y:12531383-12531405 GGTGGGGCACAGAGCAGCTCTGG + Intergenic