ID: 1196401555

View in Genome Browser
Species Human (GRCh38)
Location X:115322458-115322480
Sequence CAGCTGTTCTTTTGGTCAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196401555_1196401558 -7 Left 1196401555 X:115322458-115322480 CCTTTTGACCAAAAGAACAGCTG No data
Right 1196401558 X:115322474-115322496 ACAGCTGGCACACACTGATAAGG No data
1196401555_1196401561 8 Left 1196401555 X:115322458-115322480 CCTTTTGACCAAAAGAACAGCTG No data
Right 1196401561 X:115322489-115322511 TGATAAGGGAACTTGCACAAGGG No data
1196401555_1196401560 7 Left 1196401555 X:115322458-115322480 CCTTTTGACCAAAAGAACAGCTG No data
Right 1196401560 X:115322488-115322510 CTGATAAGGGAACTTGCACAAGG No data
1196401555_1196401559 -6 Left 1196401555 X:115322458-115322480 CCTTTTGACCAAAAGAACAGCTG No data
Right 1196401559 X:115322475-115322497 CAGCTGGCACACACTGATAAGGG No data
1196401555_1196401564 25 Left 1196401555 X:115322458-115322480 CCTTTTGACCAAAAGAACAGCTG No data
Right 1196401564 X:115322506-115322528 CAAGGGGGCTTTCCTAAGATAGG No data
1196401555_1196401562 9 Left 1196401555 X:115322458-115322480 CCTTTTGACCAAAAGAACAGCTG No data
Right 1196401562 X:115322490-115322512 GATAAGGGAACTTGCACAAGGGG No data
1196401555_1196401563 10 Left 1196401555 X:115322458-115322480 CCTTTTGACCAAAAGAACAGCTG No data
Right 1196401563 X:115322491-115322513 ATAAGGGAACTTGCACAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196401555 Original CRISPR CAGCTGTTCTTTTGGTCAAA AGG (reversed) Intergenic
No off target data available for this crispr