ID: 1196407984

View in Genome Browser
Species Human (GRCh38)
Location X:115385771-115385793
Sequence ATGCAGATCTTTAAGCCGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196407975_1196407984 28 Left 1196407975 X:115385720-115385742 CCAAGGTATAGGTACTGTAAATG No data
Right 1196407984 X:115385771-115385793 ATGCAGATCTTTAAGCCGGAAGG No data
1196407982_1196407984 -9 Left 1196407982 X:115385757-115385779 CCACAAAACAAAGAATGCAGATC No data
Right 1196407984 X:115385771-115385793 ATGCAGATCTTTAAGCCGGAAGG No data
1196407979_1196407984 -4 Left 1196407979 X:115385752-115385774 CCCGCCCACAAAACAAAGAATGC No data
Right 1196407984 X:115385771-115385793 ATGCAGATCTTTAAGCCGGAAGG No data
1196407981_1196407984 -8 Left 1196407981 X:115385756-115385778 CCCACAAAACAAAGAATGCAGAT No data
Right 1196407984 X:115385771-115385793 ATGCAGATCTTTAAGCCGGAAGG No data
1196407980_1196407984 -5 Left 1196407980 X:115385753-115385775 CCGCCCACAAAACAAAGAATGCA No data
Right 1196407984 X:115385771-115385793 ATGCAGATCTTTAAGCCGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196407984 Original CRISPR ATGCAGATCTTTAAGCCGGA AGG Intergenic
No off target data available for this crispr