ID: 1196411522

View in Genome Browser
Species Human (GRCh38)
Location X:115424966-115424988
Sequence CCCAGAGAGAAGTGGATGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 364
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 328}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196411518_1196411522 3 Left 1196411518 X:115424940-115424962 CCAAATCATATCAGAGGGCATAG 0: 1
1: 0
2: 1
3: 61
4: 438
Right 1196411522 X:115424966-115424988 CCCAGAGAGAAGTGGATGCAGGG 0: 1
1: 0
2: 1
3: 34
4: 328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196411522 Original CRISPR CCCAGAGAGAAGTGGATGCA GGG Intergenic
901138549 1:7013136-7013158 CCCAGCGAGAAGTGCTGGCACGG - Intronic
901656207 1:10771098-10771120 CCCAGCTAGAAATGGAGGCAGGG + Intronic
901770566 1:11528373-11528395 TCCACAGATAAATGGATGCAGGG - Intronic
902097967 1:13962108-13962130 CACTTGGAGAAGTGGATGCAGGG + Intergenic
902361713 1:15945642-15945664 CCCAGTGCGCAGTGGAGGCAGGG + Intronic
902763174 1:18597652-18597674 CCCAGAAAGAAGGGGCTTCATGG + Intergenic
903669716 1:25028227-25028249 CCCAGAAAGAAGAGGAAGAAGGG - Intergenic
904675895 1:32199131-32199153 CCCAGAGAGAACAGGGTGCTGGG - Intergenic
905396067 1:37667480-37667502 CCCAGAGACAGGGGGCTGCATGG - Intergenic
905867861 1:41386047-41386069 CCCAGAGAGGAGGGTGTGCATGG - Intergenic
906150043 1:43582452-43582474 CCCAGAGAGCTGTAGATGGAAGG - Intronic
907338459 1:53716114-53716136 CCCACAGAGGAGGGGAGGCAAGG + Intronic
908957316 1:69648776-69648798 CACAGAGAGAACTGAGTGCAAGG - Intronic
909912147 1:81274150-81274172 CCCAGAGAGCAGAAAATGCATGG + Intergenic
910262795 1:85308024-85308046 CCCAGAGATAGGTGGCAGCAGGG + Intergenic
911253829 1:95611198-95611220 ACCAAAGAGAAGTGGGTGAAGGG - Intergenic
912746865 1:112252388-112252410 CCCAGAGAGCAGTGAAGGCCAGG + Intergenic
913061321 1:115211103-115211125 CCCACACAGATGTGGAAGCAGGG - Intergenic
913134388 1:115873882-115873904 CACAGAGTGAAGTGAAAGCAAGG + Intergenic
914429856 1:147611446-147611468 CCCTGATGGAAGTGGAGGCATGG + Intronic
916934878 1:169617383-169617405 ACCAGAAAGAAGTGGCAGCATGG - Exonic
919416816 1:197320988-197321010 ATCAGAGAGAAGGAGATGCATGG - Intronic
919853127 1:201687252-201687274 CCCAGGGGGAAGTGGCTGGAAGG + Intronic
919855808 1:201705296-201705318 GCCAGAGAGAGGAGCATGCACGG - Intronic
922323642 1:224509500-224509522 GCCAGGGAGAAGGGGCTGCATGG - Intronic
922559501 1:226558909-226558931 CCCAGTGAGAACTGGGTGCTGGG + Intronic
922737611 1:227996326-227996348 GCCAGAGAGGAGTGACTGCATGG + Intergenic
922886365 1:229023967-229023989 CCTTTAGAGAAGTGGATGCTGGG - Intergenic
923271032 1:232355153-232355175 CCCAGGGAGAAAAGGAAGCAAGG + Intergenic
923437049 1:233977175-233977197 CCCAGAGAGAAGCAGGTGCAGGG - Intronic
1063090369 10:2860617-2860639 CCCACAGGGGTGTGGATGCAGGG + Intergenic
1064050309 10:12054165-12054187 CCAAGCGAAAAGTGGTTGCATGG + Intergenic
1064509256 10:16071725-16071747 CCCAGAGAGAGGTAGGTGTAAGG + Intergenic
1065897898 10:30180628-30180650 GCCTGAGAGAAGAGTATGCAGGG + Intergenic
1067246519 10:44551457-44551479 CCTGGAGGGAAGTGGAGGCAAGG - Intergenic
1069095057 10:64249390-64249412 GCCAGAGAGGCGGGGATGCAGGG + Intergenic
1069496114 10:68904699-68904721 TACAGAGAGAAGTTGAAGCAAGG - Intronic
1070357850 10:75658010-75658032 GCCAGAGAGAAGGGGAGGAAAGG - Intronic
1070566318 10:77606135-77606157 CCTAGAGAGAGGCTGATGCAGGG - Intronic
1070576032 10:77679843-77679865 CCCTGGGAGAAGAAGATGCAAGG + Intergenic
1071141835 10:82518721-82518743 CACAGAGAGAGGTGGAAGGAAGG + Intronic
1072027100 10:91470813-91470835 CCCAGAACCAAGTGGATTCACGG + Intronic
1074621169 10:115124581-115124603 CCGAGAGAGAAGGGGATGGGAGG - Intronic
1074906391 10:117867855-117867877 CCCAGAGAGAAGGGGCTGTAGGG + Intergenic
1075063741 10:119274824-119274846 CCCAGTGAGAGGTGGAACCAAGG - Intronic
1075087273 10:119422003-119422025 CCCATAGGGAAGAGGAGGCAAGG + Intronic
1075766176 10:124894839-124894861 CCTAGAGAGAAGTGGCTGGCCGG + Intergenic
1076727454 10:132420217-132420239 CCCAGACAGAGCTGGAAGCAGGG + Intergenic
1076751674 10:132546535-132546557 CCAAGAGAGAAGGGGGAGCACGG - Intronic
1076806629 10:132862247-132862269 CCCAGAGAGAAGGGCTGGCAAGG + Intronic
1076898718 10:133326613-133326635 CCCCTAGAGAGGTGGCTGCAGGG + Intronic
1077052092 11:571529-571551 CCCAGAGCCAGGTGGATGCCTGG - Intergenic
1077278977 11:1733418-1733440 CCCAGGCAGAGGTGGATGGAGGG - Exonic
1077285396 11:1763241-1763263 CCCTGAGAGAGGAGGAGGCATGG - Intronic
1077353329 11:2103145-2103167 AGGAGAGAGAAGGGGATGCAGGG - Intergenic
1077390158 11:2297092-2297114 CCCAGAGAGCATGGGCTGCAGGG + Intronic
1078950406 11:16125704-16125726 CCCAAAGAGAAGTGGAAGGATGG + Intronic
1079513097 11:21234185-21234207 CCCAGAGAAAAATGCAAGCATGG + Intronic
1081492927 11:43581179-43581201 CCCCGAGAGAAGTGTGTGGAGGG - Intronic
1081853024 11:46286920-46286942 CCCAGAGTGGGGTGGATTCAGGG - Intronic
1081874644 11:46400326-46400348 GGCAGAGAGAAGGGGATGGATGG - Intronic
1083300275 11:61736411-61736433 CACAGAGAGGAGAGGATGGATGG + Intronic
1083334063 11:61912703-61912725 CCCAGAGGAAAGGGGATGAATGG + Intronic
1083887397 11:65579524-65579546 TCCAGATAGAAGAGGATGCGGGG + Intronic
1084020491 11:66414378-66414400 GGCTGAGAGAAGAGGATGCAAGG - Intergenic
1084240531 11:67816885-67816907 GCCAGAGCGCAGTTGATGCAGGG + Intergenic
1084359670 11:68661274-68661296 CCCAGAGAGAAGAAGCTTCAAGG - Intergenic
1085033148 11:73284694-73284716 CACAGAGAGGACTGGGTGCACGG - Intronic
1085414927 11:76313531-76313553 GCCAGAGAGAAGCGGAGCCAGGG + Intergenic
1086138226 11:83464386-83464408 CCCAGAGAGTAGTGAATGCTAGG - Intronic
1086427245 11:86697356-86697378 CACAGGGAGTTGTGGATGCAAGG + Intergenic
1089260512 11:117220902-117220924 CACAGAGAGAAGGGGTTTCATGG - Intronic
1089739273 11:120571204-120571226 CCAAGAAAGAAGAAGATGCAAGG - Intronic
1089830851 11:121326593-121326615 CTCAGAGAGGAATGGATGGAAGG - Intergenic
1090249899 11:125244004-125244026 CCCAGAGCCAAGTGGATGAATGG + Intronic
1092000198 12:5025300-5025322 CCCACAGAGAATTGGGTGGAAGG + Intergenic
1092457083 12:8653465-8653487 ACCAGAGAGACGTTTATGCAAGG - Intronic
1092948213 12:13476114-13476136 ATCAGAGAGAAGCGGAGGCAGGG + Intergenic
1095342604 12:41109454-41109476 CTTAATGAGAAGTGGATGCAGGG - Intergenic
1095974041 12:47927223-47927245 CCCAGAGAGAGCTGGAAGCATGG + Intronic
1096127180 12:49128505-49128527 GCCAGAGGGAAGTGGATGCGGGG + Exonic
1096134133 12:49185557-49185579 GCCAGAGGGAAGTGGATGCGGGG + Exonic
1096145006 12:49272664-49272686 GCCAGAGGGAAGTGGATGCGGGG - Exonic
1097398051 12:59100322-59100344 CGCAGAGAGAAATGGTTGCGGGG - Intergenic
1097872214 12:64610811-64610833 CGCAGAGACACGTGGAGGCAGGG - Intronic
1098988947 12:77043739-77043761 CCCAGTGAGAAGGGGTTGGATGG + Intronic
1099457436 12:82880818-82880840 TGAAAAGAGAAGTGGATGCAGGG + Intronic
1099578810 12:84415250-84415272 CACAGAGAGAAATGGATACCTGG - Intergenic
1099938097 12:89152331-89152353 GCTAGAGAGAAGTTGATGCCTGG + Intergenic
1101640264 12:106582090-106582112 GACAAAGAGAAGTGGAGGCAGGG + Intronic
1101877685 12:108606498-108606520 CTCAGAAAGAAAGGGATGCAGGG - Intergenic
1102466679 12:113134537-113134559 CCCAGAGAGAAGCAGGTTCAAGG + Intronic
1102539894 12:113610959-113610981 CCCAGAGAAAAGTCCGTGCAAGG + Intergenic
1102786464 12:115608989-115609011 GCCAGAGAGAAGTGGATGGGGGG + Intergenic
1103197655 12:119059115-119059137 CCCAAACAGAAGTGGTTACAGGG - Intronic
1105307179 13:19177174-19177196 GCCAGGGGGAAGTGGATGCGGGG + Exonic
1106938469 13:34750214-34750236 CCCAGGGGGAAGCGGAGGCAGGG - Intergenic
1107161285 13:37231534-37231556 CTCACAGAGTAGTGGAAGCAGGG - Intergenic
1107276565 13:38686814-38686836 CCCAGAGAGTAGCGCAAGCAGGG + Intergenic
1108114528 13:47112284-47112306 CCCAAAGAGAACAGGATCCATGG - Intergenic
1110078100 13:71275668-71275690 TCCAGAGAGAGGTGGTTTCAAGG - Intergenic
1110410338 13:75197918-75197940 CCCAGAGGGCAGTGGAAGCTGGG + Intergenic
1112391657 13:98990638-98990660 CCCTGAGATAAGTGGAAACATGG - Intronic
1113365580 13:109672608-109672630 CCCAGAGAGGAATGTATGCATGG - Intergenic
1114559429 14:23579472-23579494 CCCAGAGAGAAATGGGTGGTGGG - Intergenic
1114633914 14:24176939-24176961 GACAGAGAGAAGTACATGCAAGG - Intronic
1114893321 14:26953176-26953198 CACAGAGAAAAGTGCATGGATGG + Intergenic
1117983383 14:61363784-61363806 ACCAGACAGAAGTGGAGGGATGG + Intronic
1119552094 14:75522511-75522533 CCCAGAGTGAGGAGGACGCAGGG + Exonic
1120610649 14:86637135-86637157 AGGAGAGAGAAGTGGAAGCAGGG - Intergenic
1120616993 14:86719024-86719046 CCCAGAGAGAATAGGAGACAGGG + Intergenic
1122281763 14:100627648-100627670 CTCAAAGAGAAGAGGAGGCAGGG - Intergenic
1122341734 14:101033038-101033060 CCCAGAGAGAGGTGGATTCGAGG - Intergenic
1202902363 14_GL000194v1_random:51137-51159 CCCAGGGACAGGTTGATGCAGGG - Intergenic
1123705096 15:22945351-22945373 CCCAGAGAGGACTAGAGGCAGGG + Intronic
1126050491 15:44680556-44680578 CACAGAGAAAAGTGGCTGAAGGG - Intronic
1128370783 15:67037541-67037563 CTCAGGGAGGAGAGGATGCAAGG - Intergenic
1128714041 15:69893955-69893977 CCCAGGGAGAACTTGCTGCATGG - Intergenic
1129265954 15:74393173-74393195 GCCAGAGAGAGGAGGGTGCAGGG - Intergenic
1130301676 15:82684156-82684178 CCTAGAGAGAAGTCAATGCCTGG - Intronic
1130545732 15:84856833-84856855 CAGGGAGAGAAGGGGATGCAGGG + Exonic
1130871955 15:87978661-87978683 TCCAGAGAGAAGAGGAAGTAGGG + Intronic
1131295693 15:91147386-91147408 CCAAGAGGGGAGTGGCTGCATGG - Intronic
1132014062 15:98300400-98300422 CCCAGAGCAAAGTGGATGCAAGG - Intergenic
1132057937 15:98666386-98666408 CCCAAAAAGAAGTGAAAGCAGGG + Intronic
1133180311 16:4049264-4049286 ACCAGAGAGAAGAGGGTCCAGGG + Intronic
1134119374 16:11572851-11572873 CCCATAGGGAAGTAGATGCTGGG + Intronic
1135464668 16:22675132-22675154 GCCAGAGAGCAGTGGATGGAGGG + Intergenic
1137401106 16:48155134-48155156 GGCAGAGGGAAGTGCATGCAGGG + Intronic
1137549130 16:49424846-49424868 CCCAGAGTGAAGGGGAGGAAAGG - Intergenic
1138658397 16:58503631-58503653 CCCAGAGAGGACTGAATGGATGG - Intronic
1139509559 16:67419293-67419315 CCCTGAGTCAAGTGGATCCAGGG - Intergenic
1140851890 16:78942791-78942813 ACCAGAGAGAAGTGCATGAACGG - Intronic
1141482166 16:84313737-84313759 CCCAGAGAGGAGCGGGTGCGTGG + Intronic
1143457731 17:7078587-7078609 CCTAGTGTGAAGAGGATGCAAGG - Intronic
1143698448 17:8638580-8638602 CACAGAGAGAAAAGAATGCAGGG + Intergenic
1143711850 17:8741056-8741078 CACTGAGAGGAGGGGATGCAGGG + Intronic
1143816286 17:9518375-9518397 CCAAGAGAGGAGAGGATTCATGG - Intronic
1146419008 17:32665026-32665048 CCCTGAGACAAGAGGATGCCTGG - Intronic
1146482890 17:33219245-33219267 CCCAGAGAGAAGAGGAAGAAAGG + Intronic
1146788594 17:35738747-35738769 CCCAGAGAGGAGTGGGTGGGAGG + Intronic
1147130483 17:38405008-38405030 CGGAGACAGAAGTGGTTGCAAGG - Exonic
1147132115 17:38415655-38415677 CCGAGAGAGAAGTGGGTGTCAGG - Intergenic
1147169662 17:38610575-38610597 CCCAGAGTGAGGTGGGTGCTAGG - Intergenic
1148169216 17:45505255-45505277 GCCAGAGAGGGGTGGATACAAGG - Intergenic
1148366312 17:47058127-47058149 GCCAGAGAGAGGTGGATACGAGG + Intergenic
1148457312 17:47818049-47818071 CATAGACAGACGTGGATGCAGGG - Intronic
1148892788 17:50820039-50820061 CCCAGAGGGAAGGGGATACTCGG + Intergenic
1149559166 17:57595916-57595938 CACAGTGAGAAGTGGAAGCCAGG + Intronic
1149585744 17:57785184-57785206 CACTAAGAGAAGAGGATGCAGGG + Intergenic
1150400410 17:64851723-64851745 GCCAGAGAGAGGTGGATACAAGG - Intergenic
1150613665 17:66752776-66752798 CTCAGTGACAAGTGGCTGCATGG - Intronic
1150621571 17:66811801-66811823 CCCAGAGGGAAGAGAACGCAGGG - Intergenic
1150738426 17:67759932-67759954 CCCAGAGAGGAGAGGAAGGAAGG + Intergenic
1150920007 17:69472772-69472794 CCCAGGGAGTAGAGGCTGCAGGG - Intronic
1151166013 17:72204410-72204432 AACACAGAGAAGTGGAAGCAGGG + Intergenic
1151369033 17:73635848-73635870 CCCAGAGAGAGATGGAGACAAGG + Intronic
1152611783 17:81318478-81318500 TCCAGAGAGACGTGTATGAATGG + Intronic
1152625120 17:81384464-81384486 CCCAGAGATCAGAGGCTGCAAGG - Intergenic
1154462628 18:14609645-14609667 ACAAGACAGAAGTGGATTCAGGG - Intergenic
1155260711 18:24039366-24039388 CACAAAGAGAAGTGTATTCAAGG + Intronic
1155767023 18:29648834-29648856 AGCAGAGAGAAGTGAAAGCAGGG - Intergenic
1156309812 18:35911571-35911593 ACCAGAGAGGTGTAGATGCAAGG - Intergenic
1156801566 18:41121265-41121287 GCAAGAGAGTAGTGGATGCCAGG + Intergenic
1158312448 18:56172722-56172744 GCAAGAGAGAAGTAGATGGAAGG - Intergenic
1159023976 18:63166170-63166192 CCCAGAGAGAGGTGGTTGGCAGG + Intronic
1159962624 18:74567439-74567461 CACAGAGAGCAGTGCATGGATGG + Intronic
1160133386 18:76249737-76249759 ACCAGAGAGATGTGGAGGGACGG + Intergenic
1164846895 19:31439904-31439926 CTCAGAGAGAAGTGTGTGAAGGG + Intergenic
925221014 2:2141081-2141103 CCCATGGAGAAGTGTATGGATGG + Intronic
926608372 2:14920496-14920518 GCCAGAGAGAAGTCAATGCCTGG - Intergenic
926937643 2:18102510-18102532 TCCAGAAAGAAGTGGAAGCAGGG - Intronic
926979244 2:18549635-18549657 GCTAGAGAGAAGTCAATGCATGG + Intergenic
927857193 2:26535138-26535160 CCCAGGGAGAAATGGAGGCAGGG + Intronic
928198848 2:29234073-29234095 CCCAGAGGGAAGTGGGTGAGTGG + Intronic
928423504 2:31158583-31158605 TTCAGAGGGAAGTGCATGCAGGG + Intergenic
929037770 2:37711237-37711259 CCCAGAGAGAAGTTGTTGTGGGG - Intronic
929795000 2:45052436-45052458 CCCAGAGAGGAGAGGATGGGAGG - Intergenic
933552546 2:83793403-83793425 CCCAGAGAAGAGTAGATACACGG + Intergenic
933685252 2:85136234-85136256 CCTAAAGAGAAATGGGTGCATGG - Intronic
935295160 2:101642949-101642971 GCCAGAGAGAAGTCAATGCTTGG - Intergenic
936089356 2:109490926-109490948 CCCAGAGAGAGGTAAGTGCAGGG + Exonic
938298562 2:130194033-130194055 GCCAGGGGGAAGTGGATGCGGGG + Exonic
938458168 2:131480480-131480502 GCCAGGGGGAAGTGGATGCGGGG - Exonic
938870914 2:135475325-135475347 CAGACAGAGAAGTGGATGGAGGG - Intronic
940549939 2:155141028-155141050 CCAAAAAAGAAGTGGAAGCAAGG - Intergenic
940880013 2:158937199-158937221 CCAGGAGTGAAGAGGATGCAGGG - Intergenic
941386171 2:164855055-164855077 GCCAGAGAGAAGTATATGCATGG - Intergenic
941433945 2:165445101-165445123 GCCAGAGAGAAGTCAATGCCTGG + Intergenic
941918331 2:170826679-170826701 CCCAGAGGGAAGGGGCTTCAAGG + Intronic
941944005 2:171074549-171074571 CCCAGAAGGCAGTGGTTGCAGGG + Intronic
943288575 2:186038661-186038683 CCCATAGAGAAATGAATGCTTGG + Intergenic
943392966 2:187293446-187293468 CCAAGAGAGAAAGGGATGAAAGG - Intergenic
945575154 2:211521655-211521677 GCCAGAGAGAAGTCAATGCCTGG + Intronic
945775316 2:214100141-214100163 GCAAGAGAGAAGTGCAAGCAGGG - Intronic
946366248 2:219250890-219250912 GCCAGGGGGAAGTGGATGCGAGG + Exonic
946414062 2:219530583-219530605 CCAACAGACATGTGGATGCATGG + Intronic
947635128 2:231676563-231676585 CTCAGAGAGAAGGGGAAGAAAGG + Intergenic
947817909 2:233050314-233050336 TCCAGACAGGAGAGGATGCAGGG + Intergenic
948721162 2:239901054-239901076 GCTAGAGAGAAGTCAATGCAGGG + Intronic
1169414970 20:5408480-5408502 CCCAGAGACAAGGGTATCCATGG + Intergenic
1170013107 20:11749647-11749669 CCCAGAGAGAACTGACTTCAGGG - Intergenic
1171135180 20:22688996-22689018 CCCAGTGATGGGTGGATGCAAGG + Intergenic
1172527003 20:35606017-35606039 CCCAGAGAGGAGTGGTAACAAGG - Intergenic
1172536993 20:35681620-35681642 CCCAGAGTGAGGAGGTTGCAGGG + Intronic
1172785420 20:37465183-37465205 CCAGGAAAGAAGTGGATGCTGGG - Intergenic
1173168016 20:40699754-40699776 CCCCAAGAGAAGTTGAGGCAAGG - Intergenic
1173259458 20:41420789-41420811 CACATGGAGAGGTGGATGCATGG - Exonic
1174683049 20:52426584-52426606 CCAAGAGAAAAGGGGATGAATGG + Intergenic
1175443459 20:59006076-59006098 CCCAGTGACAAGTGGCTGCCAGG - Intronic
1176621731 21:9065904-9065926 CCCAGGGACAGGTTGATGCAGGG - Intergenic
1176711642 21:10155130-10155152 CCCAGGGAGAAGACTATGCACGG - Intergenic
1177873866 21:26607700-26607722 TCCAGAGAAAGGTGGATGTAAGG - Intergenic
1177907796 21:26993243-26993265 GGCAGAGAGAGGTGGAAGCAAGG - Intergenic
1178159456 21:29894799-29894821 CTCAAACAGAAGTGGATCCAGGG - Intronic
1178631282 21:34263575-34263597 CCCAGTAAGAAGTGGAGACAAGG - Intergenic
1178846295 21:36176726-36176748 GCCAGAGACAAATGGATGCTGGG - Intronic
1179558434 21:42195325-42195347 GCCAGAGAGCAGTGGCTGAAGGG + Intergenic
1180417692 22:12783797-12783819 GCTAGAGAGAAGTTGATGCCTGG + Intergenic
1180751373 22:18126765-18126787 ACCAGCGGGAAGTGGATGCGGGG - Exonic
1181885923 22:26022450-26022472 TACAGAAAGAAGTGGATGCAAGG + Intronic
1182481472 22:30611917-30611939 CCTCTTGAGAAGTGGATGCAGGG + Intronic
1183166573 22:36152072-36152094 CCCAGGGAGAAGGAAATGCAAGG + Intronic
1183183104 22:36274786-36274808 CCCAGTGAGAAGGGAATCCAAGG + Intergenic
1183233148 22:36595692-36595714 TCCAGAGGAAAGGGGATGCAGGG + Intronic
1183302799 22:37066519-37066541 CCCACAGTGAGGTGGATGCATGG - Intronic
1183343432 22:37294408-37294430 CCCCAAGACAAGTGGAGGCATGG + Intronic
1184275182 22:43405821-43405843 CCCAGAGAGAAGAGGACACAGGG + Intergenic
1185210654 22:49568849-49568871 CACAGAGGGAAGCGGCTGCAGGG - Intronic
949879105 3:8647975-8647997 CCCAGAGAGAGGAGGGTGCTTGG - Intronic
951121080 3:18929899-18929921 AGCAGACAGAATTGGATGCATGG - Intergenic
952034848 3:29188026-29188048 GCAAGAGAGGAGTAGATGCAGGG - Intergenic
952153802 3:30621150-30621172 CCCATAGAGGAGTGGCTACATGG - Intronic
953865450 3:46579550-46579572 CCCAGTGTGAAGTGGACTCAGGG - Intronic
953959996 3:47259316-47259338 CCCTGAGGGAAGTGTATACAGGG - Intronic
954263455 3:49456354-49456376 GACAGAGAGAAGAGGTTGCAGGG - Intergenic
954670792 3:52290386-52290408 CCGCCAGAGGAGTGGATGCAAGG - Exonic
956210844 3:66799699-66799721 CCCAGAGAAAAATGGCTCCATGG - Intergenic
959287204 3:104429998-104430020 CCCTGAGAGAAATGAATGCCTGG - Intergenic
959784849 3:110283672-110283694 GGCAGAGAGAAGTGGATGCTCGG - Intergenic
961809091 3:129511186-129511208 CCCAGAGAGAATAGGTAGCAGGG - Intronic
963592987 3:147286474-147286496 CCCAGGCAGAAGTTGTTGCAGGG - Intergenic
964200047 3:154108845-154108867 CCCACAAAGAAATGGAGGCATGG + Intergenic
964344024 3:155738113-155738135 CACAGAGAGAAGAGGCTGCTTGG + Intronic
968757635 4:2425295-2425317 CTCAGAGAGAAGGGGAGGCCAGG - Intronic
968939672 4:3631316-3631338 CCCAGAGAAAAGTGGGATCAAGG - Intergenic
969522031 4:7683979-7684001 GCCAGGGACCAGTGGATGCAAGG + Intronic
969976923 4:11112724-11112746 CTCAGAGATATCTGGATGCAGGG + Intergenic
970231674 4:13917223-13917245 CCTAGAGAGAAGAGGTTGGAGGG - Intergenic
970708674 4:18836257-18836279 TCCAGAGAGATGGGGATGGATGG + Intergenic
972112892 4:35587520-35587542 CTCAGAGGGAAGGGGATGAATGG - Intergenic
973364104 4:49193496-49193518 GCTAGAGAGAAGTTGATGCCTGG - Intergenic
973847713 4:54929834-54929856 CCTAGAAAGAAGTGCTTGCATGG - Intergenic
977992383 4:103460259-103460281 GCTAGAGAGAAGTGAATGCCTGG - Intergenic
980089309 4:128425549-128425571 ACCAGAGAGAAGTGGCTGAGAGG + Intergenic
980577813 4:134708267-134708289 CCCATAGGGAAGTGGTTGCCAGG - Intergenic
981971404 4:150666703-150666725 TCCACAGAGAATTGGTTGCAGGG - Intronic
982322714 4:154096377-154096399 TCCAGATAGAAATGGATGCATGG - Intergenic
982580592 4:157174768-157174790 AGCAGAGAGGAGTGGATGCAGGG - Intergenic
985118521 4:186616130-186616152 GACAGGGAGGAGTGGATGCAAGG - Intronic
987043772 5:14087322-14087344 CCCAGATAGAAGTGGTTGGATGG - Intergenic
988843003 5:35101437-35101459 CCCACTGAGATGTGGCTGCAAGG + Intronic
989456654 5:41651681-41651703 CCCAGAGAGAAATAGATTAATGG - Intergenic
990607925 5:57428916-57428938 CCCAGACAGGAGGGGCTGCATGG + Intergenic
990992245 5:61697748-61697770 CCTAGACAGAGGTGGCTGCAGGG - Intronic
991656743 5:68911959-68911981 CCCAGGGAGCAGTGGGGGCAGGG - Intergenic
995589581 5:113685527-113685549 TGCAGAGAGAACAGGATGCAAGG + Intergenic
995834117 5:116383462-116383484 CCCACAGAGAAGCACATGCATGG - Intronic
996746896 5:126853666-126853688 ACCAGAGTGAAGTTGATGCTTGG + Intergenic
997466330 5:134090431-134090453 CCCAGAGAGAAGCAGAGGCTTGG - Intergenic
997827192 5:137116888-137116910 CACAGAGAAAGGTGGATGGAGGG - Intronic
999631622 5:153577325-153577347 CCCAGAGATAAATGATTGCAGGG - Intronic
999823623 5:155253251-155253273 CACAGAGCCAAGTGCATGCAGGG - Intergenic
999856842 5:155604358-155604380 GCTAGAGAGAAGTCGATGCCTGG - Intergenic
1001894320 5:175365423-175365445 CCCAGAGAGAAGCAGATACAAGG - Intergenic
1001910076 5:175508954-175508976 CCTAGAGACAAGTGGCTACAAGG - Intronic
1001925562 5:175633714-175633736 CCCAGAGAGCAGCAAATGCAAGG + Intergenic
1002640234 5:180627248-180627270 CCAACAGAGAAGGGGAGGCAGGG + Intronic
1003912460 6:10754770-10754792 CCCAGTGGGAATTGCATGCAGGG + Intronic
1004485968 6:16066923-16066945 CCCTGAGAAAGGTGGGTGCAGGG + Intergenic
1006379156 6:33687732-33687754 CCCAGACAGAAATGGAAGCAAGG + Intronic
1006441949 6:34058576-34058598 CCCTGAGAGGAGGGGATTCAGGG + Intronic
1006641317 6:35491191-35491213 CCAGGAGAGATGTGGAGGCAGGG + Intronic
1007337166 6:41162193-41162215 CCAAGAGAGAAGTCAAAGCAGGG - Intronic
1007359149 6:41342744-41342766 CCCAGGGAGAAGGGGACACATGG + Intronic
1011234022 6:85195490-85195512 CCAAAAGAGATGTGCATGCATGG - Intergenic
1013469092 6:110445268-110445290 CAAAGATAGAAGTGGATGAAAGG - Intronic
1014615718 6:123596550-123596572 CCTAGAGAGAAGTCAATGCTTGG + Intronic
1015175780 6:130306685-130306707 CCCAAAGATAAGTGTATACAGGG + Intronic
1016933372 6:149430123-149430145 CACAGAGAGCAGTGGGTACATGG + Intergenic
1017131711 6:151113518-151113540 CCAAGACAGAGGTGGAGGCAGGG + Intergenic
1022385598 7:29896046-29896068 TCCAGAGAGAAGAGGAAGAAGGG + Intronic
1023788808 7:43735828-43735850 ACCAGAGGGAAGTTGATGCTGGG + Intergenic
1024210228 7:47197061-47197083 AACAGAGAGAAGGGGATGCAAGG - Intergenic
1025946034 7:66105277-66105299 CCCCGGGAGCAGTGGTTGCAGGG + Intronic
1027234408 7:76289554-76289576 CCCACACAGAAGTGGGAGCAGGG - Intergenic
1028357525 7:89927052-89927074 TCCAGAGATAAGGAGATGCATGG + Intergenic
1028433054 7:90770607-90770629 TCCAGAGGGATGTGGATGCTGGG - Intronic
1028934725 7:96452287-96452309 CCCAGAAACAAGGGGATGAATGG + Intergenic
1030858409 7:114590754-114590776 TCTAGGGAGAAGTGGATGAAGGG + Intronic
1031028634 7:116710922-116710944 CCAAGAGCCAAGTGCATGCAGGG - Intronic
1031951881 7:127901196-127901218 CCCACTGAGAAGTGGTAGCAAGG + Intronic
1032859273 7:135862163-135862185 CCCAGTGAGTAGTGGTTCCATGG - Intergenic
1033360952 7:140638816-140638838 CCCAGAGAGGAGCCGGTGCAGGG - Intronic
1034323667 7:150209324-150209346 GAGAGAGAGAAGTGGAAGCAGGG + Intergenic
1034561544 7:151882966-151882988 CACGCAGAGAAGTGGAGGCAGGG + Intergenic
1034647969 7:152665213-152665235 CCAAGACAGAAGTAGATTCAAGG - Intronic
1034769530 7:153759883-153759905 GAGAGAGAGAAGTGGAAGCAGGG - Intergenic
1034781498 7:153886553-153886575 CCCGGAGGGAAGTGGAGGCCGGG + Intergenic
1037145867 8:15572106-15572128 GCTAGAGAGAAGTCGATGCCTGG - Intronic
1037814873 8:22106847-22106869 CCCACAGAGACGTGTAGGCAGGG + Intergenic
1038286703 8:26211890-26211912 CCCAGAGGGCAGAGGTTGCAGGG - Intergenic
1038527009 8:28283536-28283558 GCTAGAGAGAAGTGAATGCCTGG + Intergenic
1038724419 8:30067848-30067870 ACCTGGGAGAAGTGAATGCATGG - Intronic
1039260538 8:35766517-35766539 CCCAGACCGAAGTAGAAGCATGG + Intronic
1039478302 8:37853186-37853208 CCCAGAGAGAAATGGCTGGGAGG - Intergenic
1040532413 8:48276479-48276501 CCCCGGGAGAAGTGCATACAGGG + Intergenic
1042368351 8:67962497-67962519 CCCAGAGGTATGTGGATGAAGGG + Intronic
1042507243 8:69573717-69573739 CCTGGAGATAAGTGGATGAACGG - Intronic
1042943353 8:74129939-74129961 CCCACTGAGCAGTGGAGGCATGG - Intergenic
1043687880 8:83110774-83110796 GCTAGAGAGAAGTGAATGCCCGG - Intergenic
1044376110 8:91473006-91473028 GCAAGAGAGAAGTGCAAGCAGGG - Intergenic
1044389436 8:91632195-91632217 CCCAAAGCAAAGTGGATGAAAGG - Intergenic
1047638719 8:126795410-126795432 AGGAGAGAGAAGTGCATGCAGGG - Intergenic
1048241529 8:132747114-132747136 CCTAGAGAGAAATGAAAGCATGG + Intronic
1048454498 8:134565720-134565742 CCCAGAGAGAAGGGCATCAAGGG + Intronic
1049169065 8:141147185-141147207 CCCAGAGTGAAGTGGCAGCAAGG - Intronic
1049566226 8:143340517-143340539 AGCAGAGAGAAGTGGAAGGAGGG - Intronic
1053025262 9:34724042-34724064 ACCACAGAGAAGGGGATGCGGGG - Exonic
1053303870 9:36970333-36970355 CCCTGAGAGAAGGGGGTGAAAGG + Intronic
1054451100 9:65404014-65404036 CCCAGAGAAAAGTGGGATCAAGG + Intergenic
1056545926 9:87613774-87613796 CCCAGAGAGAAGCAGAGACAGGG - Intronic
1056831861 9:89923603-89923625 GCCAGAGAGGAGACGATGCAGGG + Intergenic
1058166645 9:101626533-101626555 CCCAGAGAGAAGTGGTGAGAGGG + Intronic
1059328646 9:113520511-113520533 CCCAGAGAGGGGTGGAAGTAGGG - Intronic
1059399358 9:114059220-114059242 CCCACAGAGAAGAGGAGGTAGGG + Intergenic
1059672212 9:116502522-116502544 ATCAGAGAGAAGTGGATAGAAGG + Intronic
1060210326 9:121706440-121706462 CTCAGAGAGAAGTGGAGGGGAGG - Intronic
1060216456 9:121741365-121741387 CCCAGAGAGGTCTGGAGGCAGGG + Intronic
1061206119 9:129164492-129164514 CCCTGAGAGGAGAGGATCCAAGG + Intergenic
1062289261 9:135787226-135787248 CGCAGAGAGAGGGGGCTGCACGG - Intronic
1202796397 9_KI270719v1_random:124119-124141 CCCAGGGAGAAGACTATGCACGG - Intergenic
1203744918 Un_GL000218v1:36314-36336 CCCAGGGACAGGTTGATGCAGGG - Intergenic
1203565188 Un_KI270744v1:83170-83192 CCCAGGGACAGGTTGATGCAGGG + Intergenic
1185623302 X:1466422-1466444 CACAGAGAGAAGAGGTTGCCCGG + Exonic
1186759532 X:12709014-12709036 CACAGAGAAAGGTGGATGAAAGG + Intronic
1187736994 X:22314955-22314977 GAGAGGGAGAAGTGGATGCAAGG - Intergenic
1190105303 X:47556405-47556427 CTCAGAGAAATGTGCATGCACGG + Intergenic
1190966951 X:55309866-55309888 GCCAGAATGAAGTGGATGTAGGG - Intergenic
1192030596 X:67508759-67508781 ACTAGAGAGAACTGGATGAAGGG + Intergenic
1192234542 X:69287310-69287332 CCCAGAGAGGAGGGGAGGGAGGG + Intergenic
1192367596 X:70487293-70487315 CCCAGCCAGACTTGGATGCACGG + Intronic
1193205227 X:78739991-78740013 GCCAGAGTGACCTGGATGCAAGG + Intergenic
1195967664 X:110443403-110443425 CCCAGGGAGCACTTGATGCAGGG + Intronic
1195998262 X:110753358-110753380 TCCATAGAGAAGTAGATTCATGG + Intronic
1196411522 X:115424966-115424988 CCCAGAGAGAAGTGGATGCAGGG + Intergenic
1197893519 X:131288371-131288393 CCCTGAGAGGAGTGGGAGCAAGG - Intronic
1199145060 X:144355557-144355579 GCTAGAGAGAAGTCAATGCATGG - Intergenic
1201158253 Y:11151357-11151379 CCCAGGGACAGGTTGATGCAGGG - Intergenic
1201609249 Y:15822814-15822836 CCCAGCGAAAGGTGGAGGCAAGG - Intergenic
1202271224 Y:23076413-23076435 CACAGAGAGAAGTGGAGGCCAGG + Intergenic
1202294802 Y:23344269-23344291 CACAGAGAGAAGTGGAGGCCAGG - Intergenic
1202424219 Y:24710157-24710179 CACAGAGAGAAGTGGAGGCCAGG + Intergenic
1202446570 Y:24959928-24959950 CACAGAGAGAAGTGGAGGCCAGG - Intergenic