ID: 1196425934

View in Genome Browser
Species Human (GRCh38)
Location X:115569693-115569715
Sequence CCATGGAAGGGTCTGTGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 252}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196425934_1196425942 30 Left 1196425934 X:115569693-115569715 CCATTTCACAGACCCTTCCATGG 0: 1
1: 0
2: 2
3: 13
4: 252
Right 1196425942 X:115569746-115569768 TCACTCACCAAAGACTTTATTGG 0: 1
1: 0
2: 1
3: 13
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196425934 Original CRISPR CCATGGAAGGGTCTGTGAAA TGG (reversed) Intronic
900264191 1:1749178-1749200 CCAGAGAAGGGTCTGTGCCAAGG + Intergenic
902059638 1:13631285-13631307 CCAGGGAAGGGCCTGACAAAGGG + Intergenic
902751465 1:18514591-18514613 ACATGGGAGGCTCTGTGAACTGG + Intergenic
903288459 1:22291843-22291865 CCATGGAAGGGTTTGAGAAGGGG + Intergenic
904683029 1:32241824-32241846 CCATGTCATCGTCTGTGAAATGG + Intergenic
905274093 1:36806005-36806027 CCATGGAATGAGCTGTGAGACGG + Intronic
906698020 1:47837801-47837823 CCATGGAAGGGGCCTGGAAAAGG - Intronic
906698082 1:47838188-47838210 CCATGGATGTGTCTGACAAAGGG - Intronic
907332920 1:53683057-53683079 CAAGGGAATGGTCTGTGCAAAGG + Intronic
907464464 1:54625492-54625514 GCATGGAAGGGTGTGTTAACTGG + Intronic
907587506 1:55634265-55634287 CCAAGGCAGGGTCTTTCAAATGG + Intergenic
907754681 1:57300103-57300125 ACATGGAAGGCTCTGTGCAGGGG - Intronic
908462220 1:64356935-64356957 CCATGGAAAGGCATATGAAAAGG - Intergenic
910235924 1:85036562-85036584 CCATGGAAGGGCTTTTGATAGGG - Intronic
911779775 1:101861498-101861520 CCATAGAAGGTTCAGGGAAAGGG + Intronic
912680782 1:111727519-111727541 CCATAGGAGTGTCTGTGGAAGGG - Exonic
914221161 1:145683081-145683103 CAATGGAGTGTTCTGTGAAAGGG - Intronic
914473733 1:148005954-148005976 CAATGGAGTGTTCTGTGAAAGGG - Intergenic
914681578 1:149942484-149942506 ACAGGGAAGGGTCAGGGAAAGGG + Exonic
915733909 1:158072610-158072632 CCAGGGAAAGGCCTGTGCAAGGG + Intronic
916805806 1:168260305-168260327 GCATGGAAGGGTATCTTAAAGGG + Intergenic
922074785 1:222232822-222232844 CCATGGAATGGTTTGAGAGAGGG - Intergenic
1064111550 10:12543634-12543656 ACATTGAAGGGTTTGTGAACTGG - Intronic
1065924779 10:30425931-30425953 CCATGCAATGGTTTGGGAAACGG - Intergenic
1067249391 10:44574484-44574506 CCATCTCAGGGTCTGTGAGAGGG - Intergenic
1068133163 10:52920677-52920699 CCATGTAAGAGTCTATGTAAGGG + Intergenic
1070527298 10:77306218-77306240 CCTTGCAAGGGTCCCTGAAAGGG + Intronic
1070627504 10:78061742-78061764 CCACAGGAGGGGCTGTGAAATGG + Intergenic
1071305826 10:84298205-84298227 CCCTGAGAGGGGCTGTGAAATGG - Intergenic
1073144462 10:101271393-101271415 CCATTGAAAGGGCTGTGACATGG + Intergenic
1073446327 10:103582583-103582605 TCCTGGAAGGGGCAGTGAAAGGG + Intronic
1075776807 10:124994428-124994450 CCATGGAAGCTTCTGTCGAAAGG - Intronic
1077187879 11:1243555-1243577 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188300 11:1245226-1245248 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188835 11:1247326-1247348 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077189254 11:1248997-1249019 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077954014 11:6993525-6993547 TCATGGAAGGGTAAGTGAGAGGG - Intergenic
1077974860 11:7237515-7237537 ACATGGAAGGCTCTGTGAAAAGG + Intergenic
1078630527 11:12999711-12999733 CCATCGAAGACTCTGTCAAAAGG - Intergenic
1081384505 11:42455698-42455720 TCATGTAAGCATCTGTGAAACGG - Intergenic
1081745292 11:45468587-45468609 CCATTTCTGGGTCTGTGAAAAGG - Intergenic
1082264922 11:50108028-50108050 CCTAGAAAGGGTGTGTGAAAAGG - Intergenic
1082797333 11:57387709-57387731 CGATGGAAAGGTCTGGGAGATGG - Intronic
1082891769 11:58146791-58146813 AAATGCAAAGGTCTGTGAAATGG + Intronic
1083614697 11:64020580-64020602 CCATGGCAGAGTCTATGAAAAGG - Intronic
1083738455 11:64694936-64694958 CAGTGGAAGGGTCTGGGAGAGGG - Intronic
1084698515 11:70770611-70770633 CAATGGACGGCTCTGGGAAAGGG + Intronic
1086568010 11:88248836-88248858 GAATGGAGGGGTCTGAGAAATGG + Intergenic
1086818105 11:91399423-91399445 CAATAAAATGGTCTGTGAAAAGG - Intergenic
1087790546 11:102402262-102402284 CCATGAAAGTCTCAGTGAAATGG - Intronic
1089094524 11:115907975-115907997 CCATGGAAGAGTCAGTGCTAAGG + Intergenic
1089304331 11:117517278-117517300 CCTGGGAAGGAGCTGTGAAAGGG + Intronic
1089663814 11:120003837-120003859 CCATGGTAGGTCCTCTGAAAGGG - Intergenic
1090959346 11:131542418-131542440 CCATGGGAGCGTCTGGAAAATGG - Intronic
1092049439 12:5457380-5457402 CCAGAGAAGGGTCTGTGATAAGG - Intronic
1092236929 12:6816221-6816243 ACAAGGAAGTGTCTGTAAAACGG + Exonic
1096421799 12:51464999-51465021 CAATGGAAGGGCCACTGAAAAGG + Intronic
1100214752 12:92435828-92435850 CCATGGAAAGGGCTGTGAGAGGG - Intergenic
1102021071 12:109683356-109683378 GGATGGAAGGGTGAGTGAAAGGG + Intergenic
1102764120 12:115416825-115416847 CGAAGGCAGGGTGTGTGAAATGG + Intergenic
1103407021 12:120683059-120683081 CAAAGGAAGAGTCTGTGAATCGG + Intergenic
1104133077 12:125913407-125913429 ACATGGAGGGCTCTGTGCAAAGG - Intergenic
1105823350 13:24099510-24099532 CCATGGAAAGTTCTGTCAGAGGG + Intronic
1106610929 13:31279845-31279867 CCAAGGGACGGTCTCTGAAATGG - Intronic
1108601557 13:51999583-51999605 GCATGGAATGAACTGTGAAATGG - Intronic
1110630445 13:77699561-77699583 GCATGGAAGGGATTGGGAAATGG + Intronic
1112226361 13:97544446-97544468 CCATAGAAGGAGCTGTGGAAGGG - Intergenic
1112461266 13:99605857-99605879 CACTGGAAGGTTCTGAGAAACGG + Intergenic
1112547618 13:100386955-100386977 CAGTGGAAGGGTCTGTAAGATGG + Intronic
1113271797 13:108682694-108682716 GCATGGAAGGGTCAGTGATGTGG + Intronic
1114083700 14:19221397-19221419 GCCTGGAAGGGTCTGGGAAGTGG + Intergenic
1114826302 14:26084661-26084683 CCTGGGACAGGTCTGTGAAAAGG - Intergenic
1116204497 14:41846001-41846023 TTATGGAAGGGGCTCTGAAATGG - Intronic
1120258663 14:82154084-82154106 CCTTGGAATAGTCAGTGAAAAGG + Intergenic
1120635873 14:86950331-86950353 CCATAGGAGGGTATGTGAACTGG + Intergenic
1121954892 14:98204796-98204818 CCTTGGAAAGGTGTGTCAAAGGG + Intergenic
1123434694 15:20246662-20246684 CCAAGGAAGGCTTTGTGATATGG + Intergenic
1123966349 15:25463512-25463534 CCATGGAAAGCACTGAGAAATGG - Intergenic
1125935656 15:43633357-43633379 CCATTGTAGGGACTTTGAAATGG - Intronic
1125948427 15:43729821-43729843 CCATTGTAGGGACTTTGAAATGG - Intergenic
1127308890 15:57733811-57733833 CCATGGGAGAGTGGGTGAAAAGG - Intronic
1128290759 15:66476705-66476727 CCATGGCAGGCTCTGTGCAGGGG + Intronic
1128378613 15:67094758-67094780 CCCTGGAAGGGTCTGATTAAAGG - Intronic
1129050884 15:72780936-72780958 CCATTGTAGGGTTTGTGTAAAGG - Intronic
1129079844 15:73029537-73029559 CCCTGGAAGGGTGTGTGATCTGG + Intergenic
1129717737 15:77862023-77862045 GGATGGCTGGGTCTGTGAAATGG - Intergenic
1130046521 15:80450016-80450038 TCATGGAATGGTCTGGGAAAGGG + Intronic
1130123933 15:81076514-81076536 CCATGGAAGAGAGAGTGAAAAGG - Intronic
1131619322 15:94050416-94050438 CCATGGGAGGATTTGTGAAATGG - Intergenic
1131622939 15:94086737-94086759 CCTTTGAAGGGACTGTGAACAGG + Intergenic
1132772947 16:1574725-1574747 CCATGGAAGGGGGTGGGATATGG - Intronic
1136849929 16:33604440-33604462 CCAAGGAAGGCTTTGTGATATGG - Intergenic
1139672655 16:68502264-68502286 CCCTGGAAGTGTTTGTGAAGGGG - Intergenic
1140229943 16:73109313-73109335 ACATGGAAGGGTGTCTGAGATGG - Intergenic
1140281589 16:73559629-73559651 GCAAGGAAGCGTGTGTGAAAGGG - Intergenic
1203111540 16_KI270728v1_random:1452893-1452915 CCAAGGAAGGCTTTGTGATATGG - Intergenic
1142675100 17:1508640-1508662 CCAGGGAAGGGTCAGGGAGAGGG + Intronic
1143019859 17:3911718-3911740 CCAAGGGAGAGGCTGTGAAAGGG - Intronic
1148466126 17:47866298-47866320 CCAGGGAGGGGTCTCTGAGAGGG + Intergenic
1148787643 17:50153099-50153121 CCCTAGAAGGGTCTGTTAAAGGG - Intergenic
1149874908 17:60222474-60222496 TCATGGAAGAGACTATGAAATGG - Exonic
1150180665 17:63117076-63117098 CCATATAAGGATCTGTGACATGG - Intronic
1151618704 17:75231737-75231759 CTTCGGAAGGGTCAGTGAAAGGG + Intronic
1152117897 17:78399939-78399961 CGAGGGGAGGGCCTGTGAAAGGG - Intronic
1153082704 18:1247193-1247215 TAATGGAGGGGTCTGTGAAGGGG + Intergenic
1154175732 18:12086598-12086620 CCAGGGAAGGGCCAGTGCAAGGG - Intergenic
1154176158 18:12088113-12088135 CCAAGGAAGGGTCTGGGCCACGG - Intergenic
1154415705 18:14174232-14174254 CCAGGGAAGGGCCAGTGCAAGGG + Intergenic
1155138794 18:23023786-23023808 ACAACAAAGGGTCTGTGAAATGG - Intronic
1157267077 18:46234794-46234816 CCATCAAAGGGCCTGTGATAGGG + Intronic
1158102265 18:53842633-53842655 CCAAGAAAGAGTCTGTGAAGAGG - Intergenic
1158753286 18:60291305-60291327 ACATGGAAAGGTCTATGAAATGG - Intergenic
1159044448 18:63355851-63355873 GGATGGAAGGAACTGTGAAAGGG + Intronic
1159607678 18:70492442-70492464 CCATATAAACGTCTGTGAAATGG - Intergenic
1159704326 18:71667932-71667954 CAATGGAAGGATATGTGACATGG + Intergenic
1160452920 18:78978203-78978225 CCATCGATGGGTGTGTTAAACGG + Intergenic
1160460197 18:79033408-79033430 TCATGGAAGGCTCTGAGACATGG - Intergenic
1160460236 18:79033630-79033652 TCATGGAAGGCTCTGAGACATGG - Intergenic
1160460262 18:79033778-79033800 TCATGGAAGGCTCTGAGACATGG - Intergenic
1160460496 18:79035110-79035132 TCATGGAAGGCTCTGAGATATGG - Intergenic
1160460574 18:79035554-79035576 TCATGGAAGGCTCTGAGACATGG - Intergenic
1160460638 18:79035924-79035946 TCATGGAAGGCTCTGAGATATGG - Intergenic
1160460877 18:79037260-79037282 CCCTGGAAGGCTCTGAGATATGG - Intergenic
1160460895 18:79037336-79037358 CCCTGGAAGGCTCTGAGATATGG - Intergenic
1160460912 18:79037412-79037434 CCTTGGAAGGCTCTGAGATATGG - Intergenic
1160460930 18:79037488-79037510 CCCTGGAAGGCTCTGAGATATGG - Intergenic
1160460981 18:79037714-79037736 CCCTGGAAGGCTCTGAGACATGG - Intergenic
1161631697 19:5360098-5360120 CCGTGGAAGGGTCTGGAGAAGGG - Intergenic
1162304466 19:9863340-9863362 CCATGGAGGGTTCTGTGCAGAGG + Intronic
1162470488 19:10869958-10869980 CCATGCCAGGGTCTCTGCAACGG + Intergenic
1162763602 19:12904010-12904032 CCATCGAATGGTCTGTGACGGGG - Intronic
1163063532 19:14776649-14776671 CCTTGGATGCGTCTGAGAAACGG - Intronic
1163564415 19:18041701-18041723 CCATAAAAGGATCTGGGAAATGG + Intergenic
1164943346 19:32268761-32268783 GCCTGGATGGGTTTGTGAAATGG - Intergenic
1165138622 19:33686182-33686204 CAAAGGCAGGGTCTTTGAAAGGG + Intronic
1166110756 19:40621633-40621655 CCAAGGCAGGGGCTGTGGAAGGG + Intronic
1167501614 19:49851513-49851535 CCGTGGAAGGCTCTGGAAAAAGG - Intronic
1167693461 19:51001164-51001186 CCATGGTGAGGTCTGGGAAATGG + Exonic
924990791 2:311072-311094 TCAGGTAAGGGTCTGTGCAATGG + Intergenic
926339372 2:11892264-11892286 TCAAGGAAGGTTCTGTGAGAAGG - Intergenic
926482868 2:13421652-13421674 CCATGGTAGGGTCTAGAAAAGGG + Intergenic
926613641 2:14973011-14973033 CCATGGAAGGGTGTGGGAAAAGG - Intergenic
926684378 2:15687588-15687610 CCATGTAAGGGTCTTTGCAGAGG - Intergenic
929819900 2:45264504-45264526 CCAGACAGGGGTCTGTGAAAAGG + Intergenic
930222142 2:48755758-48755780 GCAGGGAAGGGTGTGTGGAAGGG - Intronic
930555478 2:52889906-52889928 CCTGGGAAGGGTGTGTGAATGGG - Intergenic
930744561 2:54868765-54868787 CCCTGGAAGGGTCTGTGTCCCGG + Intronic
931836907 2:66108738-66108760 CCGTGGAAGGGTCAGTGATATGG + Intergenic
934889084 2:98050179-98050201 TCATGAAAGGATTTGTGAAAGGG + Intergenic
936066350 2:109335389-109335411 CCAGGGTAGGGGCTGTGGAAGGG - Intronic
936474039 2:112824229-112824251 CCAGGGAAGGCCCTCTGAAAGGG - Intergenic
938460621 2:131493798-131493820 CCATGGCAGGGTCAGAGAACAGG + Intergenic
940554103 2:155200773-155200795 CCATCTTAGGGTATGTGAAATGG - Intergenic
942623391 2:177872783-177872805 ACATGGAAGGGACATTGAAATGG - Intronic
943075724 2:183191787-183191809 TCCTGGAAATGTCTGTGAAAAGG + Intergenic
943755355 2:191551409-191551431 ACATGGGAGGGTGTGAGAAATGG + Intergenic
946409237 2:219508185-219508207 CCAAGGAAGGGGCTGGGAGAGGG + Intergenic
946879110 2:224159849-224159871 GCAAGGAAGGCTGTGTGAAATGG - Intergenic
1168765852 20:381305-381327 CGACGGCGGGGTCTGTGAAAAGG - Intronic
1169209109 20:3755781-3755803 CCCTCAAGGGGTCTGTGAAAGGG - Intronic
1170587053 20:17742708-17742730 ACAGAGAAGGGTCTGTGATAGGG + Intergenic
1172032047 20:31989188-31989210 CCATGGGAGGATCTGGGAAAGGG + Intronic
1172750289 20:37245955-37245977 CAAAGGAAGGGGCTGTGAATGGG - Intergenic
1175643720 20:60653121-60653143 CCATGTAAGGGCATTTGAAAGGG + Intergenic
1176364683 21:6025738-6025760 TCAGGAAAGGGTCTGTGAACTGG + Intergenic
1176866974 21:14059155-14059177 CCAGGGAAGGGCCAGTGCAAGGG + Intergenic
1177640189 21:23835250-23835272 CCATGGGAGGGAGTGTGAAGGGG - Intergenic
1179758835 21:43512807-43512829 TCAGGAAAGGGTCTGTGAACTGG - Intergenic
1180294275 22:10871870-10871892 GCCTGGAAGGGTCTGGGAAGTGG - Intergenic
1180497081 22:15901284-15901306 GCCTGGAAGGGTCTGGGAAGTGG - Intergenic
1184621586 22:45683015-45683037 CCATGGAAGGTTCTGAGCAGAGG - Intronic
1184658028 22:45951988-45952010 CCATGGAAGGGGCAGTGAGCTGG + Intronic
1184733015 22:46381360-46381382 CCAGGGAAGTATCTGGGAAATGG + Intronic
949310035 3:2687040-2687062 CCATGACTTGGTCTGTGAAAAGG + Intronic
952123975 3:30277643-30277665 TCATGAAAGGATTTGTGAAAGGG + Intergenic
952283894 3:31949269-31949291 ACATGGAAGGTACTCTGAAAAGG - Intronic
954753669 3:52827550-52827572 CCCTGGAACAGTCCGTGAAATGG - Intronic
954809087 3:53236829-53236851 CCAAGGAAGGGGTTGTGAACAGG + Intronic
956573196 3:70720031-70720053 CACTGGAAGCATCTGTGAAATGG + Intergenic
956715480 3:72076089-72076111 CCAGGGGAAGGTCTGTAAAATGG - Intergenic
959674550 3:109020046-109020068 CCATGGAAGAGGCTTTGTAAGGG - Intronic
960754930 3:121001137-121001159 GCATGGCAGGGTCTGTGCATAGG + Intronic
960915966 3:122695111-122695133 CCATTGAAGGGCTTGAGAAAGGG + Intronic
962047377 3:131775160-131775182 CCAAAGAAGGCCCTGTGAAATGG + Intronic
963605829 3:147411013-147411035 CCAGGGAAGGGGCAGGGAAAGGG - Exonic
964293286 3:155205595-155205617 CTAGGGAAGAGTCAGTGAAATGG - Intergenic
966472381 3:180305210-180305232 GCATGCAAGGGTTTCTGAAATGG - Intergenic
968240651 3:197080877-197080899 ATTTGGAAGGGTCTGTGAAATGG + Intronic
969444968 4:7239494-7239516 CCAGGGAAGGGTCTGGGACCAGG - Intronic
969843719 4:9902609-9902631 CCAGGGAAGGGTCTGTTGCAGGG + Intronic
971188307 4:24402396-24402418 CAATGGAAGTGTTTGTTAAATGG - Intergenic
971556486 4:28018739-28018761 ACACTGAAGTGTCTGTGAAAAGG - Intergenic
973601519 4:52547345-52547367 CTATGGAAGTATCTGTGATAAGG + Intergenic
978722288 4:111924958-111924980 CCATGCAAAGGTCTGTGACCTGG + Intergenic
979302459 4:119102371-119102393 CCCTGTAAGGTTCTGTGAAGGGG + Intergenic
981782966 4:148445902-148445924 CCATCTAAGGGTGTGTGTAACGG - Intergenic
982056745 4:151557847-151557869 CTATTGTAGGGTCTCTGAAAAGG + Intronic
983536948 4:168868054-168868076 TCATGGAAGGGTCTACAAAAAGG - Intronic
984289793 4:177781269-177781291 CCCTCGAAGGGTGTGTGACAAGG + Intronic
984585388 4:181558520-181558542 TTATGGAATGGTTTGTGAAAGGG - Intergenic
984835660 4:184017899-184017921 CCATGGAAGTGTGTGAGAAGGGG + Exonic
986180603 5:5389735-5389757 CCAGGGCAGGGTCTCTGAAAAGG + Intergenic
987707527 5:21474800-21474822 CCAGGGCAGTGTCTCTGAAAAGG - Intergenic
990654197 5:57936200-57936222 CCCTGGAATGGTCTGTCCAAAGG + Intergenic
994547676 5:101187300-101187322 CCATGGATGGATCTTGGAAAGGG - Intergenic
995084400 5:108090388-108090410 CCAGGGAAGGCATTGTGAAAGGG - Intronic
996587003 5:125100579-125100601 CCATGGCAGGGTGGCTGAAATGG + Intergenic
996719138 5:126613010-126613032 ACATGGAAGGGTATGTATAATGG + Intronic
996944576 5:129051049-129051071 CCATGCAACAGTCTCTGAAACGG - Intergenic
998104403 5:139459225-139459247 CCAGGGAAGGGGCTGAGAGACGG + Intronic
999383746 5:151140057-151140079 TGGTGGTAGGGTCTGTGAAATGG - Intronic
1001099326 5:168801195-168801217 CCATGTAAGGGACTGTCACATGG - Intronic
1002671013 5:180867295-180867317 TCATGAAATGGTGTGTGAAAAGG + Intergenic
1004775579 6:18840901-18840923 CCATGGACTGCTCTATGAAAGGG + Intergenic
1005949983 6:30624748-30624770 CCATGGAGGGGTCAGGGGAAAGG + Intronic
1006398556 6:33802468-33802490 CCTTGGAAGGTTCTGTTCAAAGG - Intronic
1006450237 6:34101708-34101730 CCCTGGAAGGTTGTGTAAAACGG + Intronic
1006752403 6:36387025-36387047 CCAGGGAAGGGTCTGATAATGGG + Intronic
1007007758 6:38382634-38382656 CCAAAGAAGGTTCTTTGAAAAGG + Intronic
1007653398 6:43437256-43437278 CCATGGAAAGGTCTCAGAAGTGG + Intronic
1009020691 6:57945718-57945740 CCAGGGCAGTGTCTCTGAAAAGG + Intergenic
1009426761 6:63522765-63522787 CCATGGAAGATTCAGTGCAATGG + Intronic
1009502047 6:64425854-64425876 CCATGGAGGGATGTGTGAATGGG + Intronic
1009699343 6:67156138-67156160 CTATGTAAGTGTCTGAGAAAAGG - Intergenic
1012092695 6:94919039-94919061 CCATGCAAGCATCTGTGAAGGGG - Intergenic
1012588082 6:100947269-100947291 CCATGGAAGGGAATGGGGAAAGG + Intergenic
1013180846 6:107715865-107715887 CCATGGAAGAGACTTAGAAATGG - Intronic
1016366591 6:143325278-143325300 CCATGAAAGGGCCTTGGAAAAGG - Intronic
1017961906 6:159230798-159230820 TCATGGAAAAATCTGTGAAATGG + Intronic
1019687305 7:2388890-2388912 CCCTGGGATGGGCTGTGAAAGGG - Intergenic
1019777300 7:2919400-2919422 CCAGGTCATGGTCTGTGAAAGGG + Exonic
1021044075 7:15900791-15900813 CAATGGAACTGTCTGTGATAAGG - Intergenic
1021907637 7:25351594-25351616 CCATGGATGGCTCAGTGGAAGGG + Intergenic
1021937195 7:25642788-25642810 CCTTGGAGTGGTCTGAGAAAAGG - Intergenic
1022200028 7:28107813-28107835 CCATCGTAGGGTCTGTAAAGTGG - Intronic
1025768974 7:64485683-64485705 TCATGAAAGGATTTGTGAAAGGG + Intergenic
1032838431 7:135695278-135695300 CCCTGGATGGCTCTGTGCAAGGG - Intronic
1032850266 7:135789092-135789114 CCATGGTACGTCCTGTGAAAGGG - Intergenic
1034419356 7:150980848-150980870 CCCAGGAATGGTCTCTGAAATGG - Intergenic
1036691843 8:10949240-10949262 GCATGGAAGGGACTTAGAAACGG - Intronic
1037224997 8:16575842-16575864 CCATGAAAGGGTCCGAGAGAAGG - Intergenic
1037567559 8:20130434-20130456 CCATGGCTGGGGCTCTGAAAGGG + Intergenic
1038342329 8:26697009-26697031 TCAATGAAGGGTCTGTGAAAGGG + Intergenic
1038625913 8:29193120-29193142 CCCTGGATGGGGCTGTGAGAAGG + Intronic
1039234254 8:35484551-35484573 CCATGGAAGGGTCTTAGCAGAGG - Intronic
1040422589 8:47254009-47254031 CCATGCTAGTGGCTGTGAAATGG - Intergenic
1041822599 8:62054722-62054744 CCAAGAAGGGGTCTGTGAGAAGG + Intergenic
1041994582 8:64038500-64038522 CCATTGAGGGCACTGTGAAAAGG + Intergenic
1045740693 8:105356069-105356091 ACATGGAAGTTTTTGTGAAAGGG + Intronic
1046868888 8:119182032-119182054 CCAAGGAGAGGTCTCTGAAATGG - Intronic
1048595995 8:135866868-135866890 CCATGAAAAGGTCTGTGCATTGG + Intergenic
1049468572 8:142764880-142764902 CCAGGGAAGGGTATGAGCAAAGG - Intronic
1050485293 9:6128097-6128119 GGATGCAAGGGTCTGTGGAAGGG + Intergenic
1050656345 9:7832750-7832772 CCATGGAAGCCTCTCAGAAAGGG - Intronic
1052881530 9:33603649-33603671 CCATGGAAGGTTCTGGATAAAGG + Intergenic
1053494786 9:38542191-38542213 CCATGGAAGGTTCTGGATAAAGG - Intronic
1057025973 9:91734009-91734031 CTCTGGAAGGTTCTGTGATAAGG + Intronic
1057829004 9:98393001-98393023 GCATGGATGGGTGTGTGAATGGG - Intronic
1060032672 9:120228960-120228982 CCATGGAAGGGCATATGCAATGG - Intergenic
1062586032 9:137250511-137250533 CCAGGGCAGGGCCTGTGAACAGG - Intergenic
1186917472 X:14239014-14239036 CAATTGGAGGGTCAGTGAAAGGG - Intergenic
1188726899 X:33596406-33596428 CGATGGAAGATTCTGGGAAAAGG - Intergenic
1189171635 X:38915101-38915123 CTGTGGGAGGGTCTGTGCAAGGG + Intergenic
1189232937 X:39466184-39466206 GCATGGAAGGGGCTGTGAGTAGG - Intergenic
1195551767 X:106179738-106179760 CCATGAAATGCTTTGTGAAATGG - Intronic
1196425934 X:115569693-115569715 CCATGGAAGGGTCTGTGAAATGG - Intronic
1198017380 X:132625043-132625065 CCTTGGGAGGATCTGTGAACAGG - Intergenic
1198410110 X:136358198-136358220 CCATGAAGAGGTCTTTGAAATGG + Intronic