ID: 1196429192

View in Genome Browser
Species Human (GRCh38)
Location X:115604424-115604446
Sequence CATTAGGACCTGGGGGAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 186}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196429187_1196429192 -9 Left 1196429187 X:115604410-115604432 CCATCTGTAATCTTCATTAGGAC 0: 1
1: 0
2: 1
3: 15
4: 123
Right 1196429192 X:115604424-115604446 CATTAGGACCTGGGGGAAGTAGG 0: 1
1: 0
2: 2
3: 10
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196429192 Original CRISPR CATTAGGACCTGGGGGAAGT AGG Intronic
900252391 1:1677963-1677985 GATTGAGACCTGGGGGAGGTGGG - Intronic
900431878 1:2606493-2606515 CCTTAGGGGCTGGGGGATGTGGG + Intronic
904287156 1:29460196-29460218 CCTTGGGACCTGGGAGTAGTTGG - Intergenic
905478040 1:38242664-38242686 CATTATAGCCTGGGGGAGGTGGG - Intergenic
906324046 1:44833193-44833215 AACTGGGACCTGGGGGAGGTGGG + Intronic
908233622 1:62129853-62129875 CACTTGGACCTGGGAGAAGGAGG + Intronic
911936787 1:103986538-103986560 TATTAGGACCTGGGGCATTTAGG + Intergenic
912633573 1:111270699-111270721 CCTTAGGACCCAGGGAAAGTTGG + Intergenic
919800468 1:201350997-201351019 GATCAGAACCTGGGGGAAGGAGG + Intergenic
921793506 1:219316876-219316898 CATTAGGGGCTGGGGGGAGGAGG + Intergenic
922599677 1:226840296-226840318 CATGTGGACCTGGGAGTAGTTGG - Intergenic
924484411 1:244466766-244466788 GATCAGGACCTGGAGGAAATAGG + Intronic
924951284 1:248886122-248886144 CGTTTGGACATGGGGCAAGTTGG - Intergenic
1064942040 10:20745869-20745891 CACTAGGAGCTGGGGGAGCTGGG + Intergenic
1065550310 10:26862991-26863013 AGTTGGGACCTGGGGGAAGCGGG + Intergenic
1070386410 10:75928778-75928800 CTTTAGCACATGGAGGAAGTGGG - Intronic
1072044473 10:91640832-91640854 CAATAAGACCTGGAGAAAGTTGG - Intergenic
1073336153 10:102711244-102711266 CATTAGGACTCTGGTGAAGTGGG - Intronic
1074210596 10:111330207-111330229 CATAAGTACCTGGGGGATGTGGG + Intergenic
1074760999 10:116667535-116667557 CATTAGGACCAGAGTGAGGTTGG + Intronic
1074833410 10:117265748-117265770 CATCAGAACCTGGGGGATGCAGG + Intronic
1078401768 11:11034657-11034679 GGTTAGGACCTAGGGGAAGGCGG + Intergenic
1078442348 11:11378342-11378364 CATAAGTAGCTGGGGCAAGTAGG - Intronic
1078533315 11:12153706-12153728 TACCAGGATCTGGGGGAAGTGGG - Intronic
1079089393 11:17470102-17470124 AATTAGCAGCTTGGGGAAGTTGG + Exonic
1082295841 11:50440293-50440315 CATTTGTACCTCTGGGAAGTTGG - Intergenic
1083343206 11:61972182-61972204 CATTAGGAAATGGGGGGAGGGGG - Intergenic
1083580313 11:63820523-63820545 CATAAGGACCATGGGGAAGAAGG - Intronic
1083771666 11:64871052-64871074 CATTAGGACCATGGGGAAAGGGG + Intronic
1084662269 11:70552972-70552994 CATGAGGACACGGGGGAAGGCGG - Intronic
1088183763 11:107141013-107141035 TATTGGGACCTGGTGGAAGTGGG - Intergenic
1088748316 11:112822873-112822895 CATTAGGAACTGTGGGCAGGAGG + Intergenic
1088762417 11:112944712-112944734 GATTACCACCTGGGGGAAGATGG - Intergenic
1089639849 11:119840471-119840493 CAGTAGGATTTGGGGGAATTTGG + Intergenic
1090155502 11:124433737-124433759 CATTATCACCTGGCTGAAGTTGG + Intergenic
1090351940 11:126113462-126113484 CTTTAGGAGCTGGGGGAATAGGG - Intergenic
1093037668 12:14348043-14348065 TACCAGGGCCTGGGGGAAGTGGG - Intergenic
1093071809 12:14713716-14713738 CATGAGAACATGGAGGAAGTCGG + Intergenic
1095634050 12:44410341-44410363 CAATAGGAACTGAGGGAAATAGG - Intergenic
1097066629 12:56325301-56325323 CATCAGGGCCTGTGGGATGTGGG - Intronic
1097960274 12:65525789-65525811 CATGAGGACCAGGTGGAAGCTGG - Intergenic
1099305657 12:80951825-80951847 CATAAAGACCTGAGGGAAGGGGG - Intronic
1099972758 12:89516780-89516802 CATCAGGACCTGGGAGAGGTGGG - Intronic
1100221134 12:92505574-92505596 CACTGGCAGCTGGGGGAAGTGGG + Intergenic
1101951285 12:109177913-109177935 CATGAGGGCCTGGGGTATGTGGG - Intronic
1103003797 12:117406104-117406126 GATTAGGACCTAGGGGAGGCTGG + Intronic
1106482765 13:30149204-30149226 CACTTGGACCTGGGGGATGAAGG - Intergenic
1109180801 13:59212134-59212156 CATTAATACCTGGAGGCAGTCGG - Intergenic
1110371304 13:74743559-74743581 CCTGGGGACCAGGGGGAAGTGGG - Intergenic
1111621367 13:90730211-90730233 CATTAAGAAGTGGGGGTAGTTGG - Intergenic
1111975811 13:94966505-94966527 CATTAGGACCTGGGAGAGTCGGG + Intergenic
1113457364 13:110458174-110458196 CCGCAGGACCTGGAGGAAGTGGG + Intronic
1115140091 14:30160746-30160768 CACCAGCACCTGGAGGAAGTAGG + Intronic
1120721267 14:87891928-87891950 CATTAGGAAATGGTGGAGGTTGG + Intronic
1124863920 15:33470762-33470784 CATCAGGACATGTGAGAAGTAGG + Intronic
1125328359 15:38559894-38559916 CATTCGGAACTGGGTGATGTGGG + Exonic
1125457680 15:39877370-39877392 CATTTGGATTTGGGGGAATTTGG - Intronic
1127166147 15:56245914-56245936 AATTAGAACCTTGGGGAACTTGG - Intronic
1128119855 15:65137686-65137708 CATTAGGAACTGGTGCAAGGGGG - Intergenic
1129695049 15:77735674-77735696 CAGTAGGTCCTGGGGGTGGTGGG + Intronic
1130141214 15:81227936-81227958 CTTGAGCACCTGGGGGTAGTAGG + Intronic
1133227441 16:4348573-4348595 TATTAGGTCCTGAGGGATGTTGG - Intronic
1133812612 16:9172569-9172591 CAGTAGGTCATGGGGGGAGTGGG - Intergenic
1134058245 16:11183332-11183354 CAGTAGGACGTGGGGGAAGGGGG - Intergenic
1134367775 16:13595207-13595229 AATTTGGACCTGGGGGATTTGGG + Intergenic
1136172134 16:28495818-28495840 CACTAGGGCATGGGGGACGTGGG + Exonic
1137425759 16:48379222-48379244 CATTAGGACATGGGGGCTGGGGG + Intronic
1137821835 16:51453374-51453396 CATTCAGAGCTGGGGGAACTTGG + Intergenic
1142896986 17:2986903-2986925 CCTCATGACCTGGGGCAAGTAGG + Intronic
1147919345 17:43906727-43906749 CGCTAGGACCTGGGGGAGGGGGG + Intronic
1147989300 17:44323457-44323479 CAGTAAGACCTAGGGGAGGTGGG - Exonic
1151101093 17:71556114-71556136 AACTAGGACATGGGGAAAGTGGG - Intergenic
1152479162 17:80538444-80538466 CTTTAGGATCTGGGGGAGGAAGG + Intergenic
1152566616 17:81103210-81103232 CATCAGGGCCTGGAGGAAGGAGG - Intronic
1152987243 18:332074-332096 GATTAGGACATGGGAGAAATGGG - Intronic
1156788810 18:40947712-40947734 CACTAGGACATGAGAGAAGTGGG + Intergenic
1160031918 18:75269458-75269480 AATCATGAGCTGGGGGAAGTTGG + Intronic
1161290295 19:3490516-3490538 CAACAGGAGCTGGGGGAAGACGG + Intergenic
1164528807 19:29031705-29031727 CATTAAAACCTGGGTGAACTTGG + Intergenic
1165187830 19:34037179-34037201 CATTTGGTCCTGGGGGAGGCTGG - Intergenic
1165406508 19:35634106-35634128 CAGGAGGACCTGGGGGAGGGAGG + Intronic
1166855505 19:45781009-45781031 CATTAGGGGCTGTGGGAGGTTGG + Intronic
1167265581 19:48481399-48481421 CCTCAGGTCCTGGGGGAAGATGG - Intronic
926819910 2:16840647-16840669 CAGCAGTACCTGGGGGAAGAAGG - Intergenic
927977767 2:27352481-27352503 CATTAGGAGATGGGGGAATGGGG - Intronic
928759928 2:34570311-34570333 CTTTAGGAACTGGGAGAAGGTGG - Intergenic
930774843 2:55161490-55161512 GTCTAGGACATGGGGGAAGTGGG + Intergenic
930912981 2:56652365-56652387 AATTTGGTCCTGGGGGATGTGGG - Intergenic
932207701 2:69898090-69898112 ATTCAGGAGCTGGGGGAAGTGGG + Intronic
936052611 2:109236255-109236277 CTTTAGGACCGAGGGGAATTTGG - Intronic
937621236 2:123990054-123990076 CATTAGAACTTGGGGGAAGATGG + Intergenic
938240549 2:129739416-129739438 CATCAGAACCTGGGGAAGGTAGG - Intergenic
939317703 2:140573827-140573849 CATTACAACCTGGAGGATGTTGG + Intronic
940615487 2:156044067-156044089 CACATGGACATGGGGGAAGTGGG - Intergenic
940928313 2:159393876-159393898 CACTAGGGCCTGGGGAGAGTGGG - Intronic
944467659 2:200019394-200019416 TATCAGGAGCTGGGGGAAATGGG - Intergenic
945483842 2:210371024-210371046 GCTTAGGAGTTGGGGGAAGTGGG + Intergenic
945503563 2:210609292-210609314 GATTAGGACTTGGTGGAAGGAGG - Intronic
945773973 2:214081748-214081770 CATCAGGTACTGGGGGAAGAAGG - Intronic
946391563 2:219419500-219419522 GATGAGGCCCTGGGGGAGGTGGG + Intronic
947125597 2:226865329-226865351 CACTAGGACCTGCTGGAAGGTGG + Intronic
947601233 2:231451731-231451753 CTTTGGCACCTGGGGGAAGGGGG + Intergenic
947718387 2:232352936-232352958 GATCAGGAGCTGGGGGAAGGGGG - Intergenic
948225189 2:236304367-236304389 CAGCAGGACCTGGAGGAAGCTGG - Intergenic
948580866 2:238986488-238986510 CATTTGGACCTTGGGGCCGTTGG - Intergenic
1168930848 20:1622768-1622790 AGGTAGGACCTGGTGGAAGTTGG - Intergenic
1169197165 20:3689515-3689537 CTAAAGGACCTGGGGGAATTTGG + Intronic
1171276995 20:23865774-23865796 CATTTGGACCTGGGAGACGGAGG - Intergenic
1172870205 20:38131050-38131072 CTTTGGGGCCTGGGGGAAGCGGG - Intronic
1175847855 20:62067993-62068015 CAGAAGGCCCTGGGGAAAGTGGG + Intergenic
1178627933 21:34233728-34233750 CACTAGGAGCAGGGGGATGTGGG + Intergenic
1179336703 21:40463524-40463546 AGTTAAGACCTGGGGAAAGTGGG - Intronic
1179410943 21:41162774-41162796 CTTTGGGACCAGAGGGAAGTAGG - Intergenic
1181464849 22:23105410-23105432 CATGAGAAACTGGGGGTAGTGGG - Intronic
1181797011 22:25318498-25318520 CCTTGGGGTCTGGGGGAAGTGGG + Intergenic
1182021891 22:27088648-27088670 CATTGGGAACTTGGGGAAGAGGG + Intergenic
1183237108 22:36627181-36627203 ATCTAGGACCTGGGGGAAGGAGG + Intronic
1183706949 22:39480090-39480112 GATGAGGAGCTGGGGGAGGTTGG + Intronic
949873581 3:8609251-8609273 CATTAGGACGTGGGGCCTGTCGG - Intergenic
949926924 3:9048937-9048959 CATGGGGACCTGCGGGAAGGAGG + Intronic
952038571 3:29234134-29234156 CATCAGGACTTGGGGGAAGTAGG + Intergenic
953392915 3:42544213-42544235 CATTATGACCTGGGGAAATGTGG - Intergenic
954454148 3:50587972-50587994 GATTGGGACCTGGGGGAAATGGG + Intergenic
960316480 3:116184522-116184544 CATTTTGACCTGGGGTAACTGGG + Intronic
961209228 3:125112501-125112523 CATGAGGTGCTGGGGGAAGGGGG - Intronic
961324273 3:126101089-126101111 CACTTGGACCCGGGGGAAGGAGG - Intronic
962040848 3:131706025-131706047 CATTAGGTGCTAGGGGATGTGGG - Intronic
962084111 3:132172868-132172890 CATTAGGACCCAGGTGCAGTGGG + Intronic
967424045 3:189305816-189305838 CATAAGGACTTGGTGGAAGAAGG - Intronic
974100679 4:57412643-57412665 AATGAGGAACTGGGGGAAATTGG - Intergenic
974852859 4:67424713-67424735 TACTAGGGGCTGGGGGAAGTGGG + Intergenic
975804031 4:78093979-78094001 CATCAAGACTTGGTGGAAGTGGG - Intronic
980739806 4:136935384-136935406 CATTTGGGGGTGGGGGAAGTGGG + Intergenic
982159675 4:152555045-152555067 CCAAAGGACCTGGGGGATGTGGG + Intergenic
983413987 4:167432585-167432607 CATTATGACCTTGGGGTAATGGG - Intergenic
984429052 4:179625126-179625148 CAGTAGGCCCTGGGAGAAGGAGG - Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985085819 4:186311471-186311493 CATGAGGACCTGTGGCAAGAAGG + Intergenic
986670515 5:10139315-10139337 GCCTAGGACCTGGGGGGAGTGGG - Intergenic
987185775 5:15417473-15417495 CATTATGGCCTTGGGCAAGTGGG - Intergenic
987765386 5:22221695-22221717 CAATAGGACATGGGGGATGGGGG - Intronic
988065677 5:26227272-26227294 CTTTAGAACCTGGGAGAAGCTGG - Intergenic
990358520 5:54995238-54995260 AATTTGGGCCTGGAGGAAGTTGG - Intronic
990510780 5:56487547-56487569 CAATAGGACTAGTGGGAAGTTGG + Intergenic
992109057 5:73475229-73475251 CATTTGGACCTGGGAGATGGAGG + Intergenic
992896940 5:81253730-81253752 CTTTGGGAGCTGTGGGAAGTGGG - Intronic
997420120 5:133760159-133760181 CATCAGGCCCTTTGGGAAGTTGG + Intergenic
999122538 5:149220261-149220283 TTTTAGCACCTGTGGGAAGTTGG - Intronic
1000814916 5:165909093-165909115 CATTAGGACCTCAGCAAAGTAGG - Intergenic
1000933951 5:167285519-167285541 AATTAAGACTTGGGGAAAGTAGG - Intronic
1001908146 5:175490283-175490305 CATTCTGACCTTGGGGAAATAGG + Intronic
1003148911 6:3532187-3532209 CACCAGGGCCTGGGGGAAGGAGG - Intergenic
1004937869 6:20525718-20525740 AATTAGCACCTGGGGAAGGTGGG + Intergenic
1006800809 6:36758614-36758636 CATGAGGACTTGGGGGTATTGGG + Intronic
1008132727 6:47737323-47737345 CATTAGGAGCAGGGCAAAGTGGG + Intergenic
1008531971 6:52470122-52470144 AATTAGGAGCTGGGGGTAGGAGG + Intronic
1013835810 6:114334007-114334029 CAGGAGGACCTGGGGAAACTGGG - Intronic
1017439477 6:154450156-154450178 CATCAGGACCTGGAGGAGCTGGG - Exonic
1017869685 6:158476420-158476442 CATTAGAACCTGGGAGAAAAAGG - Intronic
1019980563 7:4618714-4618736 GATTAGGAACTGGGGTGAGTGGG + Intergenic
1021414383 7:20365414-20365436 CATTAGAAACTGGTGGAACTAGG - Intronic
1025603079 7:63017618-63017640 GATCAGGAGTTGGGGGAAGTGGG + Intergenic
1026736686 7:72953528-72953550 CATGAGGACCTGTTGGAAGTGGG - Intergenic
1026786907 7:73307600-73307622 AATGAGGACCTGTTGGAAGTGGG - Exonic
1027107048 7:75411535-75411557 CATGAGGACCTGTTGGAAGTGGG + Intergenic
1027569689 7:79848390-79848412 CATCAGGACTGGGGGGCAGTAGG - Intergenic
1027614106 7:80399951-80399973 CACTTGGACCTGGGGGACATAGG + Intronic
1028965980 7:96801661-96801683 CAGTATGAGCTGGGGGAAGGGGG + Intergenic
1030593821 7:111511856-111511878 AATTAGGAGATGGGGCAAGTAGG + Intronic
1034943450 7:155246973-155246995 CATGAGAACCTAGGGAAAGTCGG + Intergenic
1034972912 7:155430357-155430379 CCTGAGGACCTGGGGGAAAGGGG + Intergenic
1035283567 7:157792597-157792619 CAGTAGGACCTTGGGGAAGCTGG + Intronic
1035324164 7:158054195-158054217 GATTAGGGCCTGTGTGAAGTAGG + Intronic
1037609162 8:20462003-20462025 CCCTAGGACCGGTGGGAAGTGGG + Intergenic
1037858671 8:22389447-22389469 CAGGAGGACCCGGGGGAGGTGGG + Intronic
1037878019 8:22558300-22558322 CATTAGAGCCTGGGAGAAGGTGG - Intronic
1038284267 8:26192926-26192948 CATTAGATTCTGGGTGAAGTGGG - Intergenic
1039254225 8:35701381-35701403 GAGTAGGCCCTGGGGGAAGATGG - Intronic
1040525365 8:48218111-48218133 CCATAGGTCCTGGGGGAACTCGG - Intergenic
1046620717 8:116526718-116526740 CCTTAGGAGATTGGGGAAGTTGG - Intergenic
1048248150 8:132831843-132831865 CACTGGGGCCTGTGGGAAGTGGG - Intronic
1049286291 8:141777034-141777056 CAATAGGACGTGGTGGAAGTGGG + Intergenic
1053444145 9:38138509-38138531 CTTGAGGACCTGGGGGAGGAGGG + Intergenic
1059949466 9:119447134-119447156 CACTAGAACCTGGGGGGAGGTGG + Intergenic
1060822335 9:126668823-126668845 CAGGAGGGCCTGGGGGATGTGGG - Intronic
1061038485 9:128126460-128126482 CCTTAGGATTTGGGGGCAGTGGG + Intronic
1061549105 9:131322696-131322718 GATTAGGGCCTGGGGGAGGCGGG - Intergenic
1185798533 X:2987581-2987603 CACTAGGGCCTGTTGGAAGTGGG - Intergenic
1189318053 X:40069651-40069673 CAGAGGGACCTGGGAGAAGTGGG - Intronic
1190639969 X:52474902-52474924 CAGAAGGACATGGGGGAAGAAGG + Intergenic
1190647703 X:52537963-52537985 CAGAAGGACATGGGGGAAGAAGG - Intergenic
1190650756 X:52566279-52566301 CAAAAGGACATGGGGGAAGAAGG - Intergenic
1190955385 X:55187764-55187786 CACAAGGACATGGGGGAAGAAGG - Intronic
1190958419 X:55220580-55220602 CATCAGGACCTGGGGGAAGGCGG - Exonic
1191000980 X:55659338-55659360 CAGGAGGACATGGGGGAAGAAGG + Intergenic
1191031346 X:55976364-55976386 AATCAGGAGCTGGGGGAAATGGG - Intergenic
1193896836 X:87125340-87125362 TATTAGGGGCTGGGTGAAGTGGG + Intergenic
1196429192 X:115604424-115604446 CATTAGGACCTGGGGGAAGTAGG + Intronic
1200286762 X:154830173-154830195 CATTAGCAACTGGGGGAGGAAGG + Intronic