ID: 1196430877

View in Genome Browser
Species Human (GRCh38)
Location X:115623932-115623954
Sequence AAAATGCACACTTGTCGGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 203}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196430874_1196430877 11 Left 1196430874 X:115623898-115623920 CCTACTCAGCTGACAGCATTTTG 0: 1
1: 0
2: 0
3: 21
4: 319
Right 1196430877 X:115623932-115623954 AAAATGCACACTTGTCGGCCGGG 0: 1
1: 0
2: 1
3: 22
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196430877 Original CRISPR AAAATGCACACTTGTCGGCC GGG Intronic
901596624 1:10390485-10390507 AAAAGGTACACTTCTCGGCCCGG - Intergenic
906069525 1:43007100-43007122 AAAAAGCAGTCTTGTCGGCCGGG - Intergenic
906230203 1:44156126-44156148 AAAATACAGATTTGTGGGCCTGG + Intergenic
912350055 1:109003967-109003989 AAAATGTAAACTAGCCGGCCGGG + Intronic
912690679 1:111802444-111802466 AAGATGCAGACTTGCAGGCCAGG - Intronic
913288798 1:117252903-117252925 TAAATGAACAATTGTTGGCCTGG - Intergenic
915068860 1:153248772-153248794 AAAATGAACACTTGTGGTGCAGG - Intergenic
916762577 1:167830687-167830709 AAAATGCTCATTTTTTGGCCAGG - Intronic
917326240 1:173835610-173835632 AAAATTGACATTTTTCGGCCAGG + Intronic
917477142 1:175378694-175378716 AAGAAGCAGACTTGTGGGCCTGG + Intronic
919128434 1:193425258-193425280 AAAATGCACACCTACTGGCCAGG + Intergenic
919837913 1:201589141-201589163 AAAATCCAAACTTTTGGGCCGGG - Intergenic
920998333 1:211016611-211016633 AAAATTCTCATTTGTGGGCCAGG + Intronic
922879080 1:228965926-228965948 AAAATGCACACACTTCGCCCTGG - Intergenic
923178637 1:231494518-231494540 AAAATGCACACTTTGCTGCTAGG + Intergenic
1063810825 10:9705168-9705190 AAAATGCCTACTTTTGGGCCGGG + Intergenic
1069694732 10:70378345-70378367 TAAATATACACTTGTCAGCCGGG + Intronic
1070919557 10:80175759-80175781 AAAATACACAGATGTCGGCTGGG + Intronic
1071549732 10:86557412-86557434 ATAATGCACACAAGTCAGCCGGG + Intergenic
1071595019 10:86915324-86915346 AAAATTCTCACTTTTTGGCCAGG - Intronic
1072112135 10:92332867-92332889 AAAATTCACATTTGTTGGCCGGG + Intronic
1079525245 11:21378986-21379008 AAAATGTACAAGTGTTGGCCGGG - Intronic
1079812800 11:25016213-25016235 AAATTTCACACTTGATGGCCAGG - Intronic
1082127184 11:48447188-48447210 AAAAAGAAAACTTGTCGGCCAGG - Intergenic
1082560754 11:54618120-54618142 AAAAAGAAAACTTCTCGGCCAGG - Intergenic
1084609966 11:70195784-70195806 AAAATACACACTTTTGGGGCTGG + Intergenic
1084668550 11:70591719-70591741 AAAATGCAGAGATGTGGGCCGGG + Intronic
1085606764 11:77907367-77907389 AAAATGCTCATTTGAAGGCCAGG - Intronic
1088311056 11:108461018-108461040 AAAAAGCAGACTTTTTGGCCGGG - Intronic
1089543062 11:119202415-119202437 TAAAAACACACTTGTTGGCCAGG - Intergenic
1092266705 12:6986817-6986839 AAAAGTTACACCTGTCGGCCGGG + Intronic
1092296451 12:7202859-7202881 AAAATGCAGATTTCTGGGCCAGG + Intronic
1093572633 12:20685115-20685137 AAAATGAACATTTTTGGGCCGGG + Intergenic
1093757171 12:22865741-22865763 AAAATGCAGACATGGCTGCCAGG - Intergenic
1096136248 12:49204091-49204113 AAAATGCAAACTTGTCTATCTGG + Intronic
1098222657 12:68286465-68286487 AAAATTAACATTTGTGGGCCAGG + Intronic
1098924506 12:76334575-76334597 AAAATGCACTGTTCTCAGCCAGG + Intergenic
1101681545 12:106972181-106972203 AAATTGTACACTTCTCAGCCTGG + Exonic
1102710728 12:114924214-114924236 AAAATGAACATTTCTTGGCCGGG - Intergenic
1103529295 12:121589299-121589321 AAATTTCACTCTTGTCGCCCAGG - Intergenic
1103687904 12:122746806-122746828 AAAATACATACTTGTTAGCCAGG + Intergenic
1103706746 12:122878945-122878967 TAAAAGGACTCTTGTCGGCCGGG - Intronic
1103731431 12:123030396-123030418 AAAATAGATACTTGTAGGCCGGG + Intronic
1105374134 13:19828176-19828198 AAAATGCAGAGGTGTGGGCCAGG + Intronic
1106472501 13:30069965-30069987 AAGATGCAGACATGACGGCCAGG + Intergenic
1106904480 13:34390806-34390828 AAAATGCAAATTTCTGGGCCGGG - Intergenic
1108921747 13:55683487-55683509 AAAATGTACACTTTTGGGCTGGG - Intergenic
1109295421 13:60524801-60524823 AAAAAACACAATTTTCGGCCAGG + Intronic
1112350484 13:98629148-98629170 AAAATGCAGGCTTTTTGGCCAGG - Intergenic
1113984562 13:114303488-114303510 AAGAAGCAGAATTGTCGGCCCGG + Intronic
1114372985 14:22110829-22110851 TAAAAGAACAGTTGTCGGCCGGG - Intergenic
1116938778 14:50769959-50769981 AAAAGGCACATTTGGAGGCCGGG + Intronic
1122515120 14:102302366-102302388 AAAATTTACATTTGTGGGCCGGG - Intronic
1124464899 15:29928646-29928668 AAAACACACACTTGTCGGCCGGG + Intronic
1124472792 15:30003099-30003121 GAAATGCAAAATTTTCGGCCGGG - Intergenic
1126590549 15:50335601-50335623 AAAAAGAAGACTGGTCGGCCGGG + Intronic
1126762412 15:51981176-51981198 AAAATTCAGACTTATCGGCCGGG + Intronic
1128125283 15:65187705-65187727 AAAAATCTCACTTCTCGGCCAGG + Intergenic
1128474518 15:67985693-67985715 AAAATGAAGTCTTGTTGGCCGGG + Intergenic
1129316408 15:74747981-74748003 AAAATGTACACCTCTAGGCCAGG - Intergenic
1130059374 15:80558633-80558655 CAAATGCACACATGAAGGCCGGG - Intronic
1130459320 15:84148782-84148804 AAATTTCACTCTTGTCGCCCAGG + Intergenic
1131473699 15:92717915-92717937 AAAATGTACATTTGTGGGCCGGG + Intronic
1132063638 15:98712903-98712925 AAAGTGCACACTAGATGGCCGGG - Intronic
1135246177 16:20859122-20859144 AAAATGCTCACTTGACTGACAGG + Exonic
1135259743 16:20970496-20970518 CAATTTCACTCTTGTCGGCCAGG - Intronic
1135844780 16:25909099-25909121 AATATGCACACTAGTCGCCTAGG + Intronic
1138649826 16:58453489-58453511 AAAAATCACATTTGTGGGCCGGG + Intergenic
1138687996 16:58742880-58742902 AAACTGCACACATGTGGGCCGGG + Intergenic
1140281007 16:73555447-73555469 AAAATACAAACATGGCGGCCGGG - Intergenic
1142348096 16:89566704-89566726 AAGATGCACACTCGTCTTCCAGG - Exonic
1143077998 17:4361641-4361663 AAAAGACACATTTGTCAGCCAGG + Intronic
1143801647 17:9387586-9387608 AAAATGCCCACTTTTTGGCCAGG - Intronic
1143927303 17:10383200-10383222 TAAATGCACACTTACTGGCCAGG - Intergenic
1144331682 17:14229878-14229900 TAAATGCAGACTTGTCGACCTGG + Intergenic
1147612074 17:41807791-41807813 AAAATGAACTCCTGGCGGCCGGG - Intronic
1149208098 17:54272297-54272319 AAAATGCAAATTTCTAGGCCAGG - Intergenic
1150149880 17:62800388-62800410 AACATCCACACTGGTCGCCCTGG - Intronic
1150851712 17:68709583-68709605 AAAATGCACCACTATCGGCCGGG - Intergenic
1151220874 17:72612014-72612036 GAGTTTCACACTTGTCGGCCAGG - Intergenic
1152605991 17:81290549-81290571 AAAAGGCAAACTTTTAGGCCAGG + Intronic
1152668846 17:81589233-81589255 AAAATGTTCAGTAGTCGGCCGGG + Intronic
1153531659 18:6052908-6052930 ACAGTGCACACTTGTTGGCAAGG + Intronic
1153849633 18:9080937-9080959 AAAAGGTACTCTTATCGGCCGGG - Intergenic
1154319407 18:13334261-13334283 AAATTTCACACTTGTTGCCCAGG + Intronic
1155290949 18:24340997-24341019 AAAATACAAACTTTTCGGCTGGG + Intronic
1157674984 18:49562151-49562173 AAAATGAAAACTTGGCGGCACGG - Exonic
1158155491 18:54421361-54421383 AAAATGTACACTTGTTGTCTTGG - Intergenic
1158674013 18:59502094-59502116 AAAATGCTGACTCGTAGGCCAGG - Intronic
1159430597 18:68347793-68347815 AGAATGGACTATTGTCGGCCGGG - Intergenic
1160500210 18:79397903-79397925 AAAATACACCCATGTCGGTCGGG - Intronic
1161752288 19:6106998-6107020 AAAATCCACAGGTGCCGGCCGGG + Intronic
1162665397 19:12206141-12206163 GAAATGCCCACTTGTCAGCCTGG - Intergenic
1164278832 19:23750544-23750566 AAAAAACACACTAGTAGGCCAGG + Intronic
1165048019 19:33121612-33121634 AAAAAGGAGACTTGGCGGCCGGG - Intronic
1166031983 19:40138226-40138248 AATATCCACACTTCTCGGCCGGG + Intergenic
1166939183 19:46352523-46352545 AGAAGGCCCACTTCTCGGCCAGG + Intronic
1167580515 19:50338657-50338679 AAAATTGACACCTGTTGGCCAGG + Intronic
1167753263 19:51393873-51393895 AAAATGCAATGTTGTGGGCCAGG - Intergenic
1168082492 19:54020511-54020533 AAAATTCAAACTTCTAGGCCAGG + Intergenic
1168464015 19:56587485-56587507 GAAATGGGAACTTGTCGGCCAGG - Intronic
925110531 2:1331851-1331873 AAAATGCACACTCCTGGGCAGGG + Intronic
925391843 2:3500574-3500596 GAAATGCACACCTGTCCACCAGG + Intronic
929514797 2:42597358-42597380 AAAAAGATAACTTGTCGGCCAGG - Intronic
933494779 2:83036157-83036179 AAATTGCACATTTGTAAGCCTGG - Intergenic
936242254 2:110797951-110797973 AAACAGCACACATGTCAGCCTGG + Intronic
936769811 2:115898311-115898333 AACAAGCACACTTGTAAGCCTGG - Intergenic
938087687 2:128412163-128412185 AAAATGCAAGTTTGTGGGCCAGG - Intergenic
942241956 2:173971203-173971225 AAATTTCACTCTTGTCGCCCAGG + Intergenic
944212047 2:197216557-197216579 AAAAAGCACTCTGGTCAGCCTGG - Intronic
944624844 2:201560130-201560152 AAAATGTAAAATTGTGGGCCAGG + Intronic
947168931 2:227291266-227291288 ATAAAAAACACTTGTCGGCCGGG + Intronic
1168762348 20:357741-357763 AAAATGCAACCATGCCGGCCAGG + Intronic
1169360339 20:4943370-4943392 AAAATATACACTTCTGGGCCAGG + Intronic
1172635311 20:36406101-36406123 AAAATTCACTCTTGAAGGCCGGG + Intronic
1177072608 21:16529427-16529449 TAAATGTGAACTTGTCGGCCGGG + Intergenic
1178422811 21:32455769-32455791 CAAATGCTAACCTGTCGGCCTGG - Intronic
1179208994 21:39310218-39310240 AAAATTCAAATTTGTTGGCCAGG + Intronic
1180207853 21:46273268-46273290 AAAATGTACTTTTGTGGGCCAGG - Intronic
1180829273 22:18891067-18891089 TAAAGGCACACCTGTCTGCCTGG - Intergenic
1181504331 22:23341462-23341484 AAAATGAGGACTTGTCGGCAAGG - Intergenic
1181655443 22:24294073-24294095 AAAATGAGGACTTGTCGGCAAGG - Intronic
1181709322 22:24671696-24671718 AAAATGAGGACTTGTCGGCAAGG - Intergenic
1182029467 22:27146450-27146472 AAAATACACACTTGTGGGAAAGG - Intergenic
1182305234 22:29363298-29363320 AAGATGGAAACTTGTAGGCCGGG + Intronic
1182312545 22:29419452-29419474 AAGATGGAAACTTGTAGGCCGGG + Intronic
1183127766 22:35801527-35801549 AAAATGTACACTTTTGGGCCAGG + Intronic
1183396317 22:37572943-37572965 AAAAGTCACTCTTGTCGCCCAGG - Intronic
1184878180 22:47288698-47288720 AAAGTGCACACTTGTCAGGGAGG - Intergenic
1203279365 22_KI270734v1_random:117105-117127 TAAAGGCACACCTGTCTGCCTGG - Intergenic
950033773 3:9869543-9869565 AAAATGAACATGTGTTGGCCAGG - Intronic
950055768 3:10023221-10023243 AAAATGAACATGTGTTGGCCAGG - Intergenic
952019130 3:28996066-28996088 AAAATCCACAGTTGTTGGCAAGG + Intergenic
952506438 3:34010680-34010702 AAGATGCACACGTGAAGGCCGGG - Intergenic
953663963 3:44912124-44912146 AAAATACAAACTGTTCGGCCGGG - Intronic
955339375 3:58113250-58113272 AAAATCCAGACTTTTCTGCCAGG - Intronic
955416709 3:58698861-58698883 AAAATTCACAATGGTGGGCCAGG - Intergenic
957125503 3:76154804-76154826 AAAATACATATTTGTCTGCCTGG - Intronic
960387939 3:117043916-117043938 AAAATAAAAACTTCTCGGCCAGG + Intronic
960666204 3:120111517-120111539 ACATTACACACTTCTCGGCCGGG + Intergenic
960852249 3:122067965-122067987 AAAATGTACATTTGTCAACCTGG - Intronic
961349859 3:126292893-126292915 AAAAGGCTCAGTTGTCTGCCTGG + Intergenic
962561129 3:136607959-136607981 GAACTGCACACTGGTTGGCCGGG + Intronic
963036610 3:141035570-141035592 AAAAAGAAAACTTGTTGGCCAGG - Intergenic
964358062 3:155868639-155868661 AAAATACAGACTTGTTGGCCAGG - Intergenic
965418957 3:168432618-168432640 AAAATGCAAACTTCTGGGCTTGG + Intergenic
968358652 3:198130201-198130223 AAATTTCACTCTTGTCGCCCAGG + Intergenic
971181499 4:24332271-24332293 TAAATGCACTCTTCTAGGCCAGG - Intergenic
972491262 4:39589745-39589767 AAAAGGAACACTAGGCGGCCGGG + Intronic
972548159 4:40101448-40101470 ATAATGCACACTTTTTGGCGTGG - Intronic
972952159 4:44340602-44340624 AAAATGTACATATGTCGGCCGGG - Intronic
974563501 4:63553301-63553323 AAAATGCAGACTTGAGGGCTGGG - Intergenic
976237598 4:82915550-82915572 AAAAAACACACTTATGGGCCAGG - Intronic
977302525 4:95283646-95283668 AAAACGAACACTTGTCAGCTGGG + Intronic
980034865 4:127872136-127872158 AAATTGCACAGATGTCAGCCGGG + Intergenic
981340241 4:143613721-143613743 ATAATGCACACTTGATGGCTAGG - Intronic
982506733 4:156228030-156228052 AAAATCCAGACTTGGTGGCCAGG + Intergenic
983365287 4:166778899-166778921 AAAATGCAGACTTTTTAGCCTGG + Intronic
983843501 4:172486625-172486647 GAAATGCACACTTGTCTACAAGG - Intronic
985000228 4:185475297-185475319 AAAATGAAAATTTCTCGGCCGGG + Intergenic
985867030 5:2521987-2522009 TAAAATCACACTTGTCGGCTGGG - Intergenic
986190455 5:5492132-5492154 AAAATGAACACTTTTCAGCCTGG + Intergenic
986473524 5:8099271-8099293 AAAATGCATATTTTTAGGCCTGG - Intergenic
987363886 5:17131044-17131066 AAAAGGCACAATTGCTGGCCAGG - Intronic
987943266 5:24570059-24570081 AAAACACACACTTGTTGGCCGGG - Intronic
988296891 5:29375928-29375950 AAAATGAACAAATTTCGGCCGGG - Intergenic
989594985 5:43148026-43148048 AAAAAGCACTCTTGTCGCTCAGG - Intronic
991677503 5:69102347-69102369 AAAATGCACACAACTTGGCCAGG - Intronic
994762936 5:103879002-103879024 GAAATACTCACTTGTGGGCCAGG - Intergenic
995444390 5:112226458-112226480 AAAATGCACTCAGGTAGGCCTGG + Intronic
998883836 5:146673567-146673589 AAAATGCAGAATTCTCAGCCTGG - Intronic
998890992 5:146745659-146745681 AAAATGATAAATTGTCGGCCAGG + Intronic
998970913 5:147591549-147591571 AAAATACACAGTTGTAGTCCTGG + Exonic
999294758 5:150452111-150452133 AAAATGTACTATTATCGGCCAGG - Intergenic
1001807405 5:174599406-174599428 AAAATGTACACTTCCTGGCCTGG - Intergenic
1002390472 5:178907903-178907925 AAAATGCTCACTTGACTGACAGG + Intronic
1002800061 6:514158-514180 AAAAGGGTTACTTGTCGGCCTGG - Intronic
1004227279 6:13797726-13797748 AAAAAACACACTTGCCGGCCAGG + Intronic
1005842497 6:29752830-29752852 AAAATGCAGACCTGTGGGGCAGG + Intergenic
1006123209 6:31820359-31820381 AAAATTATTACTTGTCGGCCGGG + Intergenic
1009433275 6:63589625-63589647 AAAATCAACACTTGACAGCCGGG - Intergenic
1011386247 6:86801695-86801717 TAAATGAACACTTGTGGGCCTGG - Intergenic
1011495298 6:87931410-87931432 AAAAATCACTCTTGTGGGCCGGG - Intergenic
1018159088 6:161020337-161020359 AAAGTGCACACATGTGGGCAGGG - Intronic
1019186343 6:170222867-170222889 AAAACGCACAGCTGACGGCCAGG + Intergenic
1019899663 7:4010329-4010351 CAAATGCACTCTTGCCGGCAAGG - Intronic
1019911202 7:4101440-4101462 AAAATGCAAATTTTTCCGCCGGG - Intronic
1019990166 7:4684483-4684505 AAAATGCACACCTTTCAGCACGG - Intronic
1021623378 7:22569693-22569715 AAAGTGCACAGTTCTAGGCCTGG + Intronic
1022718306 7:32918945-32918967 AAAATTCACAATTATGGGCCGGG + Intergenic
1022871132 7:34480990-34481012 AAAAAGCACTCCTGTAGGCCGGG - Intergenic
1025844942 7:65187625-65187647 AAAATAAGCACTTGTGGGCCGGG - Intergenic
1028156924 7:87440693-87440715 AAAATGCACACTTACCTTCCTGG + Intronic
1030305048 7:108009217-108009239 AAAATGGTCATTTGTTGGCCAGG + Intergenic
1031531138 7:122878355-122878377 AAAACGCAATGTTGTCGGCCGGG + Intronic
1034352178 7:150423836-150423858 AAAATTCCCCCATGTCGGCCGGG + Intergenic
1038699894 8:29840180-29840202 AAAATGCACCCTTGACATCCAGG + Intergenic
1040379209 8:46856087-46856109 AAAATGCCCTCTTTTTGGCCTGG - Intergenic
1042031153 8:64477428-64477450 AGAATGCAAAGTTGCCGGCCGGG + Intergenic
1042982939 8:74550919-74550941 AAAATGTTCACTTGTAGGCATGG + Intergenic
1045369702 8:101510797-101510819 AAATTTTTCACTTGTCGGCCGGG + Intronic
1046794624 8:118357524-118357546 AAAATCTACACTTTTAGGCCAGG - Intronic
1046951230 8:120021375-120021397 AAATTTCACTCTTGTCGCCCAGG - Intronic
1050535479 9:6626998-6627020 AAAAGGCAAACTAGTGGGCCGGG + Intronic
1054786224 9:69213087-69213109 GAATTGCACTCTTGTCGCCCAGG + Intronic
1055264687 9:74481410-74481432 AAAATGCACATATGTGGGCCAGG + Intergenic
1057038379 9:91829245-91829267 AAAATGCAGACATGTTGGCTGGG + Intronic
1057901013 9:98948301-98948323 TAAAGACACACTTGTCGGCCGGG + Intronic
1058895585 9:109397976-109397998 AAAATGCAATCTTTTGGGCCGGG + Intronic
1061385833 9:130288936-130288958 AAAATGCACACCTTTGGGGCAGG - Intronic
1187342459 X:18433254-18433276 AAAAAATACACTTCTCGGCCGGG + Intronic
1189024573 X:37379116-37379138 AAAATGAAGACTTGCCTGCCAGG - Intronic
1189110963 X:38288407-38288429 AAAATGTACACTTCTTGGCCTGG + Intronic
1189773501 X:44449409-44449431 AAAATGTACACTACTCGGCCAGG + Intergenic
1190865197 X:54378504-54378526 AACATGCTCACTCTTCGGCCAGG - Intergenic
1194074138 X:89367691-89367713 AAAAGGCACATTTTTGGGCCAGG - Intergenic
1196107627 X:111913473-111913495 AAAATGAAGACTTCTCGGCTTGG + Intronic
1196208432 X:112967722-112967744 AGCTTGCACACTTGTGGGCCAGG + Intergenic
1196430877 X:115623932-115623954 AAAATGCACACTTGTCGGCCGGG + Intronic
1196854885 X:119973449-119973471 AAAATGCTTAATTGTGGGCCGGG - Intergenic
1198276543 X:135099318-135099340 AAAATGCACGCTTGTGGGTTTGG - Intergenic
1199904214 X:152207790-152207812 AAAATGAACACTTGTCAGATTGG - Intronic
1200729530 Y:6719218-6719240 AAAAGGCACATTTTTGGGCCAGG - Intergenic
1201851419 Y:18486504-18486526 AAAATGGATACTTCTCTGCCAGG + Intergenic
1201881900 Y:18833875-18833897 AAAATGGATACTTCTCTGCCAGG - Intergenic
1202330125 Y:23741090-23741112 AAAATGGAAACTTCTCTGCCAGG - Intergenic
1202540645 Y:25928972-25928994 AAAATGGAAACTTCTCTGCCAGG + Intergenic