ID: 1196434822

View in Genome Browser
Species Human (GRCh38)
Location X:115665236-115665258
Sequence GTCCCACAGCGCCACAGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 1, 2: 3, 3: 10, 4: 156}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196434818_1196434822 2 Left 1196434818 X:115665211-115665233 CCCAGCAGGAGAGGGCCAAGTAA 0: 1
1: 0
2: 3
3: 18
4: 147
Right 1196434822 X:115665236-115665258 GTCCCACAGCGCCACAGGAAAGG 0: 1
1: 1
2: 3
3: 10
4: 156
1196434814_1196434822 22 Left 1196434814 X:115665191-115665213 CCGAAAACAAGTGGAAATCGCCC 0: 1
1: 1
2: 3
3: 5
4: 57
Right 1196434822 X:115665236-115665258 GTCCCACAGCGCCACAGGAAAGG 0: 1
1: 1
2: 3
3: 10
4: 156
1196434813_1196434822 23 Left 1196434813 X:115665190-115665212 CCCGAAAACAAGTGGAAATCGCC 0: 1
1: 3
2: 2
3: 36
4: 1324
Right 1196434822 X:115665236-115665258 GTCCCACAGCGCCACAGGAAAGG 0: 1
1: 1
2: 3
3: 10
4: 156
1196434819_1196434822 1 Left 1196434819 X:115665212-115665234 CCAGCAGGAGAGGGCCAAGTAAG 0: 1
1: 0
2: 2
3: 15
4: 181
Right 1196434822 X:115665236-115665258 GTCCCACAGCGCCACAGGAAAGG 0: 1
1: 1
2: 3
3: 10
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196434822 Original CRISPR GTCCCACAGCGCCACAGGAA AGG Intergenic
900418306 1:2545067-2545089 TTCCCACAGCCCCACAGAAAGGG + Intergenic
900526126 1:3129669-3129691 GGCCCTCAGTGCCACAGGTAGGG + Intronic
901145012 1:7058933-7058955 GGCCTACAGAGCCACAGAAATGG - Intronic
901732061 1:11287138-11287160 TTTCCACAGAGCCACAGGATGGG + Exonic
902159491 1:14518621-14518643 GTCACACAGCTCAACAGCAATGG - Intergenic
902194170 1:14785475-14785497 TTTCTACAGCGCCAGAGGAACGG - Intronic
902854028 1:19186629-19186651 GTCCTGCAGCGGCAGAGGAAGGG - Exonic
903446397 1:23424939-23424961 GTCCCCCGGCGCCCCTGGAAGGG - Intergenic
904013782 1:27405362-27405384 GGGCCCCAGGGCCACAGGAATGG + Exonic
909173334 1:72322384-72322406 GGCCCAAAGGGCCACAGGATTGG - Intergenic
912656281 1:111488843-111488865 GTCCCTCAGGGCCACATGATTGG + Exonic
920019471 1:202943795-202943817 GTCCCACTGCGCCACAATGATGG + Exonic
920145971 1:203861433-203861455 GTCCTACAGCGCCACCTGGAGGG - Intergenic
920179927 1:204126302-204126324 GGCCAACAGCTCCTCAGGAAGGG - Exonic
1066013142 10:31212686-31212708 GTCCAAAAGGGCCACAGTAATGG + Intergenic
1066109383 10:32182717-32182739 GCCCGACAGCCCCACAGGACTGG + Intergenic
1067721617 10:48731856-48731878 GTCTGACAGCTCCTCAGGAATGG + Intronic
1068674568 10:59757521-59757543 GTCTCAGAGCCCCACGGGAAAGG + Intergenic
1069270628 10:66522612-66522634 GACCCACAGCTCCACAGGGCTGG - Intronic
1070594102 10:77820428-77820450 CTCCCACTGGGGCACAGGAAGGG + Intronic
1070744879 10:78927642-78927664 CTCCCACACAGCCCCAGGAAGGG + Intergenic
1075719872 10:124578340-124578362 GAGCCACAGGGCCACAGGCATGG + Intronic
1076313168 10:129522384-129522406 GTCACACACCCACACAGGAAAGG - Intronic
1076754761 10:132563373-132563395 GACCCACATCCCCACAGAAAAGG - Intronic
1078401846 11:11035366-11035388 GTCTCACATGGACACAGGAAGGG - Intergenic
1084041745 11:66546672-66546694 GTCACACAGCGCCCCAGCAGCGG + Exonic
1084381986 11:68818401-68818423 GCCCCACATCGCCAGAGCAAGGG + Intronic
1088186446 11:107176627-107176649 GTCCCACGGCACCACGGGAAAGG + Intergenic
1090274199 11:125408352-125408374 CTCCCACGGGGCCCCAGGAAGGG + Intronic
1090910396 11:131113604-131113626 GCCCCACAGAGCAACAGCAAAGG - Intergenic
1091347589 11:134865462-134865484 GCCCCACAGTTCCCCAGGAATGG - Intergenic
1092989287 12:13879695-13879717 GTCCACCATCGCCATAGGAATGG + Intronic
1094713235 12:32986180-32986202 GTCCCATGGCGTCACGGGAAAGG + Intergenic
1094756621 12:33477300-33477322 GTTCCACATGGACACAGGAAGGG - Intergenic
1096113797 12:49043494-49043516 GTCCCACAGCCCTACAGGCCAGG + Intronic
1100607233 12:96161875-96161897 GACCCAGAGGACCACAGGAATGG - Intergenic
1102131862 12:110537758-110537780 GTCCCACAAAGCCAGAGGAAGGG + Intronic
1103905470 12:124325346-124325368 GTCCCAGCGAGCCACAGGAACGG - Exonic
1104447244 12:128844487-128844509 GTCCTCCAGAGCCAGAGGAAGGG + Intergenic
1107946374 13:45420554-45420576 GTCCAAAAGCTCTACAGGAAAGG - Intergenic
1109235500 13:59813102-59813124 CTCCCACAGGGCTATAGGAAAGG - Intronic
1113607489 13:111620736-111620758 TTCCCACAGCCCCCCAGGAGAGG - Intronic
1113671561 13:112178968-112178990 GCCCCACAGCCTCACAGGGAGGG - Intergenic
1114671005 14:24411059-24411081 GTCCCACGACCCCACAGGCATGG + Exonic
1116615232 14:47128040-47128062 GTCCCACAGCTCATAAGGAATGG - Intronic
1119180846 14:72604419-72604441 GTCCCATAGGCACACAGGAAGGG - Intergenic
1119758699 14:77136555-77136577 GTCCCACAAAGCCAAAAGAAAGG + Intronic
1123183008 14:106487272-106487294 GTCCCAAAGAGCCACATGACTGG - Intergenic
1123404792 15:20013164-20013186 GTCCCACAGGGGCACAGTACAGG + Intergenic
1123514123 15:21019811-21019833 GTCCCACAGGGGCACAGTACAGG + Intergenic
1126954620 15:53918680-53918702 GTCCCACAGGGACTCAGAAATGG + Intergenic
1129122530 15:73409621-73409643 CTCCAACAGAACCACAGGAAAGG + Intergenic
1129420951 15:75426260-75426282 CTGCCCCAGCCCCACAGGAAGGG + Intronic
1131669280 15:94601954-94601976 ATCCCACAGCATCCCAGGAACGG - Intergenic
1132581773 16:688080-688102 CTCCCACAGGGCCACGGGAGTGG - Intronic
1133236628 16:4390309-4390331 GTCCTTCAGCACCATAGGAAAGG - Intronic
1135908138 16:26532786-26532808 GTCCCACAGAGCCACTAGACAGG - Intergenic
1137701934 16:50503682-50503704 ATCCCACAGGGCCCCAGGGAGGG + Intergenic
1137806333 16:51309495-51309517 GACCCACAGTGCCACAGGGCTGG - Intergenic
1142367797 16:89659238-89659260 CTCCCACTGGGCCACAGCAATGG - Intronic
1143772778 17:9179102-9179124 CTCCCAGAGCCTCACAGGAAGGG - Intronic
1143881789 17:10035506-10035528 TTCCCACAGTGCCAGGGGAAGGG - Intronic
1144080955 17:11763374-11763396 GTCCAACAGCACCACCAGAATGG + Intronic
1144745502 17:17611471-17611493 GTCCCCCAGCCCGACAGCAAGGG - Intergenic
1145250933 17:21296671-21296693 CTCCCACAGCCCTACAGGGAGGG - Intronic
1149544899 17:57496265-57496287 GCCCTACAGAGCCACAGGAATGG + Intronic
1152184367 17:78844794-78844816 GTGCCACAGGGCCACAGGAAGGG - Intergenic
1154201246 18:12302161-12302183 GTCCCAGAGTGCCACAGATAGGG - Intergenic
1157967264 18:52222360-52222382 TTTCCAGAGCCCCACAGGAATGG - Intergenic
1158166783 18:54549050-54549072 GTCCCACTGAGGCACAGGATGGG - Intergenic
1160435213 18:78846490-78846512 GACTCACAGTGCCACAGGACTGG - Intergenic
1163088378 19:15000035-15000057 TTCCCACATGGACACAGGAAGGG - Intronic
1166334066 19:42095020-42095042 GTGCCATAGCCACACAGGAAGGG - Intronic
1168258929 19:55181985-55182007 GTCCCTCAGCAACACAGGACGGG - Intronic
1202668301 1_KI270709v1_random:20235-20257 GTCCCATTGTGCTACAGGAAGGG - Intergenic
925417157 2:3678373-3678395 GTCCCACAGTGCCAGAGGAACGG - Intronic
927256470 2:21044308-21044330 GCCCCACTGAGACACAGGAAGGG - Intergenic
928493843 2:31811830-31811852 ATGCCACAGCCCCACAGGAGAGG - Intergenic
929158777 2:38811311-38811333 GTCCCACAGTGCCATGGGAAAGG - Intronic
929919197 2:46160620-46160642 GTTCCACAGCCCCACAGCACTGG - Intronic
930118053 2:47736817-47736839 GTCCCACACCACCACACTAAAGG + Intronic
930214973 2:48685884-48685906 GACCCCCAGCCCCACAGGGAAGG - Intronic
930247328 2:48997808-48997830 GTCCCACAGGGACTCAGGCAAGG - Intronic
932091154 2:68807549-68807571 GTCCCATAGCTCAACTGGAATGG - Intronic
932691541 2:73917799-73917821 CTCACCCAGAGCCACAGGAATGG + Intronic
933584861 2:84169245-84169267 ACCCCACAAAGCCACAGGAAGGG + Intergenic
933804196 2:85986490-85986512 GTCCCAGCAGGCCACAGGAATGG - Intergenic
936029475 2:109059657-109059679 GTGCCACAGTGCCAGAGGAGAGG - Intergenic
937875872 2:126824939-126824961 GACCATGAGCGCCACAGGAAAGG - Intergenic
940650454 2:156436036-156436058 GTCGCGCAGCGCCACACGCAAGG - Intronic
944213433 2:197230391-197230413 GTCCCAAAGGGCCAGATGAAAGG + Intronic
946900569 2:224367997-224368019 GCCCCACAGAGCGACAGGGAAGG - Intergenic
1170808316 20:19653638-19653660 GTCTCACATCCCCCCAGGAACGG - Intronic
1172612200 20:36260543-36260565 GTCCCTGAGTGCCACAGGCATGG - Intronic
1172899948 20:38327446-38327468 GGCCCACAGAGCCAGAGGAGTGG - Intronic
1173347611 20:42215299-42215321 GTCTCACAGAGTCACAGAAATGG - Intronic
1173595699 20:44257487-44257509 GAGCCACAGAGCCACAGGCAGGG + Intronic
1174054482 20:47788495-47788517 GGCCCACAGCCCCAGAAGAAGGG - Intergenic
1175416493 20:58804670-58804692 GTCCCACAGCGCTTCTTGAAGGG + Intergenic
1175766521 20:61596337-61596359 GGCTCACAGGGCCACAGGAGGGG + Intronic
1176191221 20:63811088-63811110 GTCCCAGAACCCCACAGGATGGG + Intronic
1176191264 20:63811214-63811236 GTCCCAGAACCCCACAGGATGGG + Intronic
1178478582 21:32958996-32959018 CCCCCACAATGCCACAGGAAAGG - Intergenic
1179377847 21:40867467-40867489 GTAGCACAGAGCCAGAGGAAGGG - Intergenic
1179513742 21:41892305-41892327 CTCCCACAGGGCCTCAGAAAGGG + Intronic
1181178791 22:21053132-21053154 GGCCCAGAGCACAACAGGAAAGG - Intronic
1181864923 22:25847375-25847397 GTCTCACAGAGACACAGAAAGGG - Intronic
1185067438 22:48639237-48639259 GACCCACAGTGCCACTGGGAAGG - Intronic
1185292497 22:50034241-50034263 GGCCCACAGCACCACAGGGAAGG - Intronic
950595381 3:13975944-13975966 GTCCCAGAGCTCCACATGATCGG + Intronic
952132633 3:30383292-30383314 GTCCTGCAGAGCCACAGGGATGG - Intergenic
953783931 3:45896493-45896515 TTCCCTCAGCGTCACAGTAAAGG + Intronic
954325565 3:49861564-49861586 GTCCCTCAGGGCCACGGGGAGGG - Exonic
955492855 3:59500422-59500444 ACCCCACAGGCCCACAGGAATGG + Intergenic
961662184 3:128475321-128475343 GGCCCTCAGGGCCACAGAAATGG - Intergenic
966194289 3:177298036-177298058 GTCCCATGGCACCACGGGAAAGG - Intergenic
967559968 3:190906013-190906035 GCCCCACAAAGCCACAGGAGTGG + Intergenic
968481070 4:833350-833372 GGCCCACAGCTCCACAGGCCTGG + Intergenic
968920712 4:3521073-3521095 GTCACACAGAGCCACAGCACAGG - Intronic
969524516 4:7697357-7697379 CTCCCACAGAGCCTCTGGAATGG - Intronic
970591511 4:17564187-17564209 ATCCCACAGGGCTACAGGATGGG + Intergenic
971944722 4:33258977-33258999 CTCCCACATGGACACAGGAAGGG - Intergenic
974337901 4:60575211-60575233 AGCCCACAATGCCACAGGAAAGG + Intergenic
981748836 4:148074514-148074536 CTTCCACAGAGCCACAGGAGGGG - Intergenic
982248188 4:153376758-153376780 GTACCACAGCACCAGAGAAAAGG - Intronic
986461430 5:7976521-7976543 GTCCGAGAGAGCCACAGGAAGGG + Intergenic
989323609 5:40165215-40165237 GTGCCCCAGTTCCACAGGAAAGG - Intergenic
989715525 5:44458156-44458178 GTCCAACAGCTGCACAGGATGGG - Intergenic
991598601 5:68329873-68329895 GTCCTATAGTCCCACAGGAATGG - Intergenic
998743294 5:145229154-145229176 GTCCCACAGCCCCACAAGAAAGG + Intergenic
1003606987 6:7571203-7571225 GTTCCCAAGAGCCACAGGAATGG - Intronic
1003682348 6:8268620-8268642 TTCCCACAGTGACAGAGGAAGGG + Intergenic
1005360197 6:25024127-25024149 GTCCCGCGGCGCCACCGGTAAGG - Intronic
1008244766 6:49158265-49158287 GCCCCACAGAGTCAAAGGAAAGG + Intergenic
1008517111 6:52328467-52328489 GTCCCACAGCAGAACAGGCAGGG + Intergenic
1014377925 6:120700153-120700175 GTCCCACACCGCAGCAGGATGGG + Intergenic
1015281080 6:131434377-131434399 GTCCCACTGGGACAAAGGAAAGG + Intergenic
1015704447 6:136072782-136072804 GTCCCGCAGCTCCACCGAAAAGG - Intronic
1018374049 6:163194769-163194791 GGCCTACTGGGCCACAGGAATGG + Intronic
1019540735 7:1549981-1550003 GTCCCCCAGGGGCCCAGGAATGG + Intronic
1022171133 7:27832891-27832913 TTCCCACAGCGACACTTGAATGG + Exonic
1024449901 7:49527770-49527792 GTCCCACAGTTCCACAGGGCTGG + Intergenic
1024709205 7:51996209-51996231 GTGCCCCAGTCCCACAGGAATGG + Intergenic
1029611302 7:101627909-101627931 GTCCCACAGCTCCAGAGGTCCGG - Intronic
1034358587 7:150474003-150474025 GTCCCACAGGCCCAAGGGAAAGG + Exonic
1034682388 7:152939022-152939044 GTGGCACAGCTCTACAGGAATGG + Intergenic
1036433596 8:8712408-8712430 GTCCCCCAGCTGCACAGGAGTGG - Intergenic
1036702578 8:11022932-11022954 GACCCACAGACACACAGGAAAGG + Intronic
1039598189 8:38809682-38809704 GTCCCACAGCCCCCAAAGAAAGG - Intronic
1040510413 8:48088343-48088365 ATCCCACAGGCCCACAGGACTGG - Intergenic
1045791386 8:105988369-105988391 GCCCTACAGAGCCACAGGAGTGG + Intergenic
1049389873 8:142362158-142362180 ATCAGACAGCGGCACAGGAAGGG + Intronic
1049968746 9:802618-802640 TTCCCAAAGCGCTACAAGAAGGG - Intergenic
1050606421 9:7305965-7305987 GAACCACAGCAGCACAGGAAAGG - Intergenic
1051365409 9:16318251-16318273 GTCCCAAAGAGCCACGAGAAGGG - Intergenic
1052927868 9:34032442-34032464 GTCCCAAGGCTTCACAGGAAAGG + Intronic
1053149297 9:35732546-35732568 GTCCCACAGTGCCACGGGGTGGG + Exonic
1055626053 9:78178603-78178625 GTCCCACGGTGCCACGGGAAAGG + Intergenic
1056100885 9:83299701-83299723 GTCCCGCATCACCACAGGAATGG + Intronic
1057198457 9:93127856-93127878 GTGCCGCAGGGCCACAGGGAGGG + Intronic
1057744459 9:97740237-97740259 GTCACACAGTGCAACAGGAGTGG + Intergenic
1059471080 9:114505241-114505263 GTCCCCCAGCCCTAGAGGAACGG - Intronic
1061296671 9:129680565-129680587 TTCCCCAAGCCCCACAGGAAGGG + Intronic
1061418025 9:130458568-130458590 GTCCCACGGCGCCACAGGAAAGG + Exonic
1062099340 9:134720086-134720108 GTGCCTCAGTGCCTCAGGAAGGG + Intronic
1062708608 9:137959662-137959684 GGTGCACAGCGCCACAGAAAGGG - Intronic
1188761778 X:34041356-34041378 GACTCACAGCTCCACAGGACTGG - Intergenic
1188801902 X:34542743-34542765 ATACCACAGAGCCACAGGGAGGG + Intergenic
1192843500 X:74881870-74881892 GTCCCTCTGAGCAACAGGAAAGG + Intronic
1196434822 X:115665236-115665258 GTCCCACAGCGCCACAGGAAAGG + Intergenic
1200055224 X:153456707-153456729 GGCCCTCAGCCCCACAGGGAAGG + Intronic