ID: 1196440081

View in Genome Browser
Species Human (GRCh38)
Location X:115711513-115711535
Sequence CAAGGACCTTTTTGAGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196440081_1196440085 2 Left 1196440081 X:115711513-115711535 CCAGCTTCTCAAAAAGGTCCTTG No data
Right 1196440085 X:115711538-115711560 AATAAAATATTGGCCAGGAGCGG No data
1196440081_1196440082 -8 Left 1196440081 X:115711513-115711535 CCAGCTTCTCAAAAAGGTCCTTG No data
Right 1196440082 X:115711528-115711550 GGTCCTTGAAAATAAAATATTGG No data
1196440081_1196440084 -3 Left 1196440081 X:115711513-115711535 CCAGCTTCTCAAAAAGGTCCTTG No data
Right 1196440084 X:115711533-115711555 TTGAAAATAAAATATTGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196440081 Original CRISPR CAAGGACCTTTTTGAGAAGC TGG (reversed) Intergenic
No off target data available for this crispr